Search Results: File:BlueGeneP schema.png

Sorry, the article you're looking for isn't specifically available. Here are related topics:


File:BlueGeneP schema.png
Rabu, 2024-01-03 11:34:07

English A schematic overview of the Blue Gene/P supercomputer determination method or standard: SHA-1...

Click to read more »
File:BlueGeneP rack.jpg
Selasa, 2025-09-23 17:31:26

A BlueGene/P node card. Taken by myself at Supercomputing 2006. November 16, 2006. English determination method or standard: SHA-1...

Click to read more »
File:IBM Blue Gene P supercomputer.jpg
Selasa, 2026-01-27 01:44:42

view of IBM Blue Gene P supercomputer which is one of the largest examples of parallel computing as of year 2023. German Die IBM Blue Gene / P-Supercomputerinstallation...

Click to read more »
File:BGP-face BMK MSU 2008.jpg
Selasa, 2023-10-10 01:01:42

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gene/P IBM на факультете ВМК МГУ object of statement has role: photographer...

Click to read more »
File:S. F. E. - Gene Stratton-Porter - A Little Story of The Life and Work and Ideals of 'The Bird Woman'.pdf
Rabu, 2025-05-14 18:35:51

English Gene Stratton-Porter: A Little Story of The Life and Work and Ideals of "The Bird Woman" described at URL: https://archive...

Click to read more »
File:Lollipop graph with c524G - T (pC175F) mutation of FOLR1 gene.jpg
Senin, 2022-06-13 14:54:48

https://creativecommons.org/licenses/by/4.0CC BY 4.0 Creative Commons Attribution 4.0 truetrue English Lollipop graph with c524G - T (pC175F) mutation of FOLR1 gene...

Click to read more »
File:Ancient gene linkages support ctenophores as sister to other animals.pdf
Senin, 2025-04-21 08:11:57

org/licenses/by/4.0CC BY 4.0 Creative Commons Attribution 4.0 truetrue English Ancient gene linkages support ctenophores as sister to other animals determination method...

Click to read more »
File:Blue Book Magazine 1929-07.pdf
Kamis, 2026-01-01 17:13:50

English Blue Book Magazine, July 1929 determination method or standard: SHA-1...

Click to read more »
File:CS.MSU.bgp-chiller-preview.jpg
Rabu, 2024-01-24 13:58:43

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gen/P в МГУ URL: https://commons.wikimedia.org/wiki/user:AGulyaev Wikimedia...

Click to read more »
File:Blue Gene main.JPG
Selasa, 2025-12-30 12:55:09

DescriptionBlue Gene main.JPG English: IBM Blue Gene/P in the National Center for Supercomputing Applications in Sofia, Bulgaria Date 17 November 2011...

Click to read more »
File:CS.MSU.bgp-back-preview.jpg
Rabu, 2024-01-24 13:58:42

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gen/P в МГУ URL: https://commons.wikimedia.org/wiki/user:AGulyaev Wikimedia...

Click to read more »
File:Blue Book Magazine 1929-03.pdf
Selasa, 2025-09-23 18:13:38

English Blue Book Magazine, March 1929 determination method or standard: SHA-1...

Click to read more »
File:CS.MSU.bgp-node-card-preview.jpg
Rabu, 2024-01-24 13:58:46

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gen/P в МГУ URL: https://commons.wikimedia.org/wiki/user:AGulyaev Wikimedia...

Click to read more »
File:CS.MSU.bgp-cnk-1-preview.jpg
Rabu, 2024-01-24 13:58:44

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gen/P в МГУ URL: https://commons.wikimedia.org/wiki/user:AGulyaev Wikimedia...

Click to read more »
File:CS.MSU.bgp-switch-preview.jpg
Rabu, 2024-01-24 13:58:48

Creative Commons Attribution-Share Alike 4.0 truetrue English Russian Blue Gen/P в МГУ URL: https://commons.wikimedia.org/wiki/user:AGulyaev Wikimedia...

Click to read more »
File:Blue Gene main side.JPG
Selasa, 2025-12-30 12:55:25

DescriptionBlue Gene main side.JPG English: An IBM Blue Gene/P at the National Center for Supercomputing Applications in Sofia, Bulgaria Date 17 November...

Click to read more »
File:Blue Gene node and board.JPG
Minggu, 2026-05-31 12:46:07

DescriptionBlue Gene node and board.JPG English: An IBM Blue Gene/P at the National Center for Supercomputing Applications in Sofia, Bulgaria Date 17 November...

Click to read more »
File:Blue Gene main side 4.JPG
Selasa, 2025-12-30 12:55:22

DescriptionBlue Gene main side 4.JPG English: An IBM Blue Gene/P at the National Center for Supercomputing Applications in Sofia, Bulgaria Date 17 November...

Click to read more »
File:S41587-020-0508-1.pdf
Senin, 2024-10-28 17:32:29

Creative Commons Attribution 4.0 truetrue English A male-biased sex-distorter gene drive for the human malaria vector Anopheles gambiae determination method...

Click to read more »
File:Application of functional genomics to primate endometrium, insights into biological processes.pdf
Senin, 2025-04-21 08:12:11

Commons Attribution 2.0 truetrue English A monograph on hormonal regulation of gene expression in endometrium tissue determination method or standard: SHA-1...

Click to read more »
File:Journal.pgen.1008895.pdf
Senin, 2023-01-02 09:20:07

org/licenses/by/4.0CC BY 4.0 Creative Commons Attribution 4.0 truetrue English Mapping gene flow between ancient hominins through demography-aware inference of the ancestral...

Click to read more »
File:Journal.ppat.1007958.pdf
Selasa, 2025-12-02 16:26:27

Creative Commons Attribution 4.0 truetrue English The mutation of Transportin 3 gene that causes limb girdle muscular dystrophy 1F induces protection against...

Click to read more »
File:Tarsal-less is expressed as a gap gene but has no gap gene phenotype in the moth midge Clogmia albipunctata.pdf
Selasa, 2025-07-22 14:56:31

DescriptionTarsal-less is expressed as a gap gene but has no gap gene phenotype in the moth midge Clogmia albipunctata.pdf English: Jiménez-Guri, Eva;...

Click to read more »
File:Transcriptome analysis and mining of genes related to shade tolerance in foxtail millet (Setaria italica (L.) P. Beauv.).pdf
Minggu, 2025-04-20 04:44:29

DescriptionTranscriptome analysis and mining of genes related to shade tolerance in foxtail millet (Setaria italica (L.) P. Beauv.).pdf English: Liu, Dan; Cui, Yanjiao;...

Click to read more »
File:How did a duplicated gene copy evolve into a restorer-of-fertility gene in a plant? The case of Oma1.pdf
Sabtu, 2025-04-19 05:47:38

DescriptionHow did a duplicated gene copy evolve into a restorer-of-fertility gene in a plant? The case of Oma1.pdf English: Arakawa, Takumi; Sugaya, Hajime;...

Click to read more »
File:Functional differences of BaPDS1 and BaPDS2 genes in Chinese kale.pdf
Selasa, 2025-11-25 21:21:32

DescriptionFunctional differences of BaPDS1 and BaPDS2 genes in Chinese kale.pdf English: Sun, Bo; Jiang, Min; Liang, Sha; Zheng, Hao; Chen, Qing; Wang...

Click to read more »
File:Halloween genes in panarthropods and the evolution of the early moulting pathway in Ecdysozoa.pdf
Sabtu, 2025-04-19 05:17:46

DescriptionHalloween genes in panarthropods and the evolution of the early moulting pathway in Ecdysozoa.pdf English: Schumann, Isabell; Kenny, Nathan;...

Click to read more »
File:Blueprint for a minimal photoautotrophic cell - conserved and variable genes in Synechococcus elongatus PCC 7942.pdf
Minggu, 2025-06-29 14:00:54

variable genes in Synechococcus elongatus PCC 7942.pdf English: Blueprint for a minimal photoautotrophic cell: conserved and variable genes in Synechococcus...

Click to read more »
File:Concurrent loss of ciliary genes WDR93 and CFAP46 in phylogenetically distant birds.pdf
Selasa, 2025-12-16 03:12:08

DescriptionConcurrent loss of ciliary genes WDR93 and CFAP46 in phylogenetically distant birds.pdf English: Salve, Buddhabhushan Girish; Kurian, Amia...

Click to read more »
File:Gene Stratton-Porter - Tales You Won't Believe.pdf
Rabu, 2025-05-14 18:47:06

hl=en&gbpv=0 Author Gene Stratton-Porter (1863–1924)      Alternative names pseudonym: Gene Stratton-Porter; Geneva Grace Stratton; Gene Stratton Porter;...

Click to read more »
File:Signatures of natural selection in abiotic stress-responsive genes of Solanum chilense.pdf
Minggu, 2025-04-20 02:44:36

DescriptionSignatures of natural selection in abiotic stress-responsive genes of Solanum chilense.pdf English: Böndel, Katharina B.; Nosenko, Tetyana;...

Click to read more »
File:Chitinase genes from Metarhizium anisopliae for the control of whitefly in cotton.pdf
Senin, 2025-12-01 08:52:28

DescriptionChitinase genes from Metarhizium anisopliae for the control of whitefly in cotton.pdf English: Anwar, Waheed; Javed, Muhammad Asim; Shahid...

Click to read more »
File:Division rate, cell size and proteome allocation - impact on gene expression noise and implications for the dynamics of genetic circuits.pdf
Sabtu, 2026-05-02 18:58:20

DescriptionDivision rate, cell size and proteome allocation - impact on gene expression noise and implications for the dynamics of genetic circuits.pdf...

Click to read more »
File:Aggressive behaviours, food deprivation and the foraging gene.pdf
Minggu, 2025-05-25 01:34:44

the foraging gene.pdf English: Wang, Silu; Sokolowski, Marla B. (2017). "Aggressive behaviours, food deprivation and the foraging gene". Royal Society...

Click to read more »
File:The relevance of gene flow with wild relatives in understanding the domestication process.pdf
Minggu, 2025-04-20 04:33:58

DescriptionThe relevance of gene flow with wild relatives in understanding the domestication process.pdf English: Moreno-Letelier, Alejandra; Aguirre-Liguori...

Click to read more »
File:Viruses-13-00148-v2 - The Kaumoebavirus LCC10 Genome Reveals a Unique Gene Strand Bias among Extended Asfarviridae.pdf
Jumat, 2025-09-26 22:17:38

Genome Reveals a Unique Gene Strand Bias among Extended Asfarviridae.pdf English: The Kaumoebavirus LCC10 Genome Reveals a Unique Gene Strand Bias among “Extended...

Click to read more »
File:Gene Stratton-Porter - Music of the Wild.pdf
Rabu, 2025-05-14 18:08:54

Author Gene Stratton-Porter (1863–1924)      Alternative names pseudonym: Gene Stratton-Porter; Geneva Grace Stratton; Gene Stratton Porter;...

Click to read more »
File:Leishmania naiffi and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.pdf
Minggu, 2025-08-24 22:33:26

and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.pdf English: Coughlan, Simone; Taylor,...

Click to read more »
File:Opsin genes of select treeshrews resolve ancestral character states within Scandentia.pdf
Sabtu, 2025-08-23 12:50:27

DescriptionOpsin genes of select treeshrews resolve ancestral character states within Scandentia.pdf English: Duytschaever, Gwen; Janiak, Mareike C.;...

Click to read more »
File:Size distribution of function-based human gene sets and the split–merge model.pdf
Minggu, 2025-04-20 02:45:05

DescriptionSize distribution of function-based human gene sets and the split–merge model.pdf English: Li, Wentian; Fontanelli, Oscar; Miramontes, Pedro...

Click to read more »
File:Phenotypic variation and differentiated gene expression of Australian plants in response to declining rainfall.pdf
Senin, 2025-10-06 13:47:00

DescriptionPhenotypic variation and differentiated gene expression of Australian plants in response to declining rainfall.pdf English: D'Agui, Haylee;...

Click to read more »
File:Phylogeny of Anophelinae using mitochondrial protein coding genes.pdf
Minggu, 2025-04-20 02:00:52

DescriptionPhylogeny of Anophelinae using mitochondrial protein coding genes.pdf English: Foster, Peter G.; de Oliveira, Tatiane Marques Porangaba; Bergo...

Click to read more »
File:Gene expression differs in susceptible and resistant amphibians exposed to Batrachochytrium dendrobatidis.pdf
Sabtu, 2025-04-19 05:16:46

DescriptionGene expression differs in susceptible and resistant amphibians exposed to Batrachochytrium dendrobatidis.pdf English: Eskew, Evan A.; Shock...

Click to read more »
File:Gene Stratton-Porter - The Magic Garden.pdf
Rabu, 2025-05-14 18:01:51

Author Gene Stratton-Porter (1863–1924)      Alternative names pseudonym: Gene Stratton-Porter; Geneva Grace Stratton; Gene Stratton Porter;...

Click to read more »
File:Madame Sans-Gêne (IA madamesansgene00lepe).pdf
Senin, 2026-01-26 22:29:15

Madame Sans-Gêne   (  ) Author Lepelletier, Edmond, 1846-1913 Title Madame Sans-Gêne Publisher New York, R.F. Fenno & co Description Subjects: Language...

Click to read more »
File:Madame Sans-Gêne; a romance (IA cu31924027283955).pdf
Jumat, 2022-12-02 00:57:48

Sans-Gêne; a romance   (  ) Author Lepelletier, Edmond, 1846-1913 Sardou, Victorien, 1831-1908 Moreau, Emile, 1852-1922 Title Madame Sans-Gêne; a romance...

Click to read more »
File:A Computer-processible nomenclature for gene symbols (IA CAT31375456).pdf
Minggu, 2025-02-09 12:17:44

A Computer-processible nomenclature for gene symbols   (  ) Author Shafton, Allan L United States. Science and Education Administration. Agricultural Research...

Click to read more »
File:Importance of metabolic rate to the relationship between the number of genes in a functional category and body size in Peto's paradox for cancer.pdf
Sabtu, 2025-04-19 06:11:08

DescriptionImportance of metabolic rate to the relationship between the number of genes in a functional category and body size in Peto's paradox for cancer.pdf...

Click to read more »
File:Host association and selection on salivary protein genes in bed bugs and related blood-feeding ectoparasites.pdf
Sabtu, 2025-04-19 05:47:28

DescriptionHost association and selection on salivary protein genes in bed bugs and related blood-feeding ectoparasites.pdf English: Talbot, Benoit; Balvín...

Click to read more »
File:Digital gene expression analyses of mammary glands from meat ewes naturally infected with clinical mastitis.pdf
Rabu, 2025-12-10 00:20:27

DescriptionDigital gene expression analyses of mammary glands from meat ewes naturally infected with clinical mastitis.pdf English: Li, Taotao; Gao, Jianfeng;...

Click to read more »
File:Global analysis of differentially expressed genes between two Japonica rice varieties induced by low temperature during the booting stage by RNA-Seq.pdf
Sabtu, 2025-07-12 23:39:46

DescriptionGlobal analysis of differentially expressed genes between two Japonica rice varieties induced by low temperature during the booting stage by...

Click to read more »
File:Are genes faster than crabs? Mitochondrial introgression exceeds larval dispersal during population expansion of the invasive crab Carcinus maenas.pdf
Senin, 2025-04-21 08:12:20

DescriptionAre genes faster than crabs? Mitochondrial introgression exceeds larval dispersal during population expansion of the invasive crab Carcinus...

Click to read more »
File:Uniform of the army of the United States, 1882.pdf
Sabtu, 2025-05-03 09:38:39

'Ps.-Two black ostrich feathers. FORAGE CAP. 2623. FO?' Gene?'ctl Ojfice?'s.-Of dark blue cloth, chasseur pattern, with black velvet band and badge...

Click to read more »
File:Extensive gene flow among populations of the cavernicolous shrimp at the northernmost distribution margin in the Ryukyu Islands, Japan.pdf
Sabtu, 2026-03-28 10:37:44

DescriptionExtensive gene flow among populations of the cavernicolous shrimp at the northernmost distribution margin in the Ryukyu Islands, Japan.pdf English:...

Click to read more »
File:Vergelijkende analyse genoom ijsvissen.jpg
Jumat, 2023-12-29 20:59:56

Creative Commons Attribution 4.0 truetrue English Phylogenetic tree and gene family gain-and-loss analysis of icefish Dutch Analyse van de fylogenetische...

Click to read more »
File:Genetic Characteristics and Phylogeny of 969-bp S Gene Sequence of SARS-CoV-2 from Hawaii Reveals the Worldwide Emerging P681H Mutation.pdf
Minggu, 2026-05-24 02:53:37

Phylogeny Of 969 Bp S Gene Sequence Of SARS Co V 2 From Hawaii Reveals The Worldwide Emerging P 681 H Mutation    (  ) Author David P. Maison, M.S., Lauren...

Click to read more »
File:The core planar cell polarity gene, Vangl2, directs adult corneal epithelial cell alignment and migration.pdf
Minggu, 2025-04-20 03:47:11

DescriptionThe core planar cell polarity gene, Vangl2, directs adult corneal epithelial cell alignment and migration.pdf English: Findlay, Amy S.; Panzica...

Click to read more »
File:Molecular phylogeny of Culex subgenus Melanoconion (Diptera - Culicidae) based on nuclear and mitochondrial protein-coding genes.pdf
Sabtu, 2025-04-19 07:31:11

nuclear and mitochondrial protein-coding genes.pdf English: Torres-Gutierrez, Carolina; de Oliveira, Tatiane M. P.; Emerson, Kevin J.; Sterlino Bergo, Eduardo;...

Click to read more »
File:Beyond Pathway Analysis Identification of Active Subnetworks in Rett Syndrome (fig 3).jpg
Sabtu, 2023-11-18 02:39:23

Attribution 4.0 truetrue English Visualization of the frontal and temporal cortex gene expression on the Microglia Pathway Phagocytosis Pathway. determination method...

Click to read more »
File:Project Blue Book report - 1957-12-6968083-SWeymouth-NewJersey.pdf
Rabu, 2024-08-21 17:21:45

DescriptionProject Blue Book report - 1957-12-6968083-SWeymouth-NewJersey.pdf English: Project Blue Book report - 1957-12-6968083-SWeymouth-NewJersey,...

Click to read more »
File:1-s2.0-S0092867423009066 co-culture Southlakia epibionticum@Actinomyces israelii.jpg
Kamis, 2026-03-05 16:43:05

4.0 Creative Commons Attribution 4.0 truetrue English Identification of genes important for fitness of ''Southlakia epibionticum'' during co-culture with...

Click to read more »
File:Project Blue Book report - 1965-10-8675652-Efland-NorthCarolina.pdf
Rabu, 2024-08-21 03:13:30

DescriptionProject Blue Book report - 1965-10-8675652-Efland-NorthCarolina.pdf English: Project Blue Book report - 1965-10-8675652-Efland-NorthCarolina...

Click to read more »
File:Analysis of the regulation networks in grapevine reveals response to waterlogging stress and candidate gene-marker selection for damage severity.pdf
Kamis, 2025-09-18 14:30:04

networks in grapevine reveals response to waterlogging stress and candidate gene-marker selection for damage severity.pdf English: Zhu, Xudong; Li, Xiaopeng;...

Click to read more »
File:Whole transcriptome analysis reveals changes in expression of immune-related genes during and after bleaching in a reef-building coral.pdf
Minggu, 2025-04-20 05:11:17

transcriptome analysis reveals changes in expression of immune-related genes during and after bleaching in a reef-building coral.pdf English: Pinzón...

Click to read more »
File:Genic polymorphism of blood proteins from white marlin. - DPLA - e270a1e961e82474b7ce31a4399cb93a.pdf
Senin, 2026-04-27 05:06:13

DescriptionGenic polymorphism of blood proteins from white marlin. - DPLA - e270a1e961e82474b7ce31a4399cb93a.pdf Fish and Wildlife Service Research Report...

Click to read more »
File:Blue Book Magazine 1923-01.pdf
Selasa, 2025-09-23 18:13:05

· Poetic Injustice [Young America] · George L. Knapp · ss 140 · Blinky · Gene Markey · ss 150 · Easy Street Experts: The Daffodil Dame [Smiler Bunn] ·...

Click to read more »
File:Gene delivery ability of polyethylenimine and polyethylene glycol dual-functionalized nanographene oxide in 11 different cell lines.pdf
Sabtu, 2025-04-19 05:16:46

DescriptionGene delivery ability of polyethylenimine and polyethylene glycol dual-functionalized nanographene oxide in 11 different cell lines.pdf English:...

Click to read more »
File:Towards Gene Banking Amphibian Maternal Germ Lines Short-Term Incubation, Cryoprotectant Tolerance and Cryopreservation of Embryonic Cells of the Frog, Limnodynastes peronii.pdf
Rabu, 2023-09-13 05:57:08

DescriptionTowards Gene Banking Amphibian Maternal Germ Lines Short-Term Incubation, Cryoprotectant Tolerance and Cryopreservation of Embryonic Cells of...

Click to read more »
File:Identification of candidate genes controlling chilling tolerance of rice in the cold region at the booting stage by BSA-Seq and RNA-Seq.pdf
Minggu, 2025-09-21 02:29:56

DescriptionIdentification of candidate genes controlling chilling tolerance of rice in the cold region at the booting stage by BSA-Seq and RNA-Seq.pdf...

Click to read more »
File:Project Blue Book report - 1950-01-9613320-Corona-NewMexico.pdf
Jumat, 2023-09-22 06:56:26

DescriptionProject Blue Book report - 1950-01-9613320-Corona-NewMexico.pdf English: Project Blue Book report - 1950-01-9613320-Corona-NewMexico, USA....

Click to read more »
File:Viruses-13-00027-v2 - Isolation and Characterization of Salmonella Jumbo-Phage pSal-SNUABM-04.pdf
Jumat, 2025-09-26 22:17:18

Characterization of Salmonella Jumbo-Phage pSal-SNUABM-04.pdf English: Isolation and Characterization of Salmonella Jumbo-Phage pSal-SNUABM-04. Viruses 2021, 13(1)...

Click to read more »
File:The story of Thomas Jefferson, by Gene Stone (IA storyofthomasjef00ston).pdf
Rabu, 2026-04-29 18:38:03

The story of Thomas Jefferson, by Gene Stone   (  ) Author Stone, Eugene E Title The story of Thomas Jefferson, by Gene Stone Publisher New York, N.Y.,...

Click to read more »
File:Project Blue Book report - 1967-03-7464536-Louisville-Kentucky.pdf
Sabtu, 2024-08-17 04:52:36

DescriptionProject Blue Book report - 1967-03-7464536-Louisville-Kentucky.pdf English: Project Blue Book report - 1967-03-7464536-Louisville-Kentucky,...

Click to read more »
File:Project Blue Book report - 1963-09-9734644-SanJose-California.pdf
Minggu, 2024-08-18 16:37:51

DescriptionProject Blue Book report - 1963-09-9734644-SanJose-California.pdf English: Project Blue Book report - 1963-09-9734644-SanJose-California, USA...

Click to read more »
File:Human C5ORF47 Conceptual Translation.pdf
Sabtu, 2022-12-17 15:46:53

Attribution-Share Alike 4.0 truetrue English Conceptual translation of the human C5ORF47 gene author name string: Ray000078 Wikimedia username: Ray000078 URL: https://commons...

Click to read more »
File:Genetics of blue spruce (IA geneticsofbluesp28hano).pdf
Selasa, 2025-11-25 11:43:06

Genetics of blue spruce   (  ) Author Hanover, J. W Title Genetics of blue spruce Series title Research paper WO Volume WO-28 Publisher Washington : Forest...

Click to read more »
File:Blue ribbon farming (IA CAT31314485).pdf
Minggu, 2024-08-18 05:00:16

Blue ribbon farming   (  ) Author United States. Soil Conservation Service WLW (Radio Station : Cincinnati, Ohio) Title Blue ribbon farming Series title...

Click to read more »
File:From conservation genetics to conservation genomics - a genome-wide assessment of blue whales (Balaenoptera musculus) in Australian feeding aggregations.pdf
Senin, 2025-11-17 08:48:46

conservation genetics to conservation genomics - a genome-wide assessment of blue whales (Balaenoptera musculus) in Australian feeding aggregations.pdf English:...

Click to read more »
File:Blue Book Magazine 1925-01.pdf
Minggu, 2026-02-08 22:57:45

DescriptionBlue Book Magazine 1925-01.pdf English: The Blue Book Magazine, January, 1925 Date January 1925 Source The Internet Archive Author Various...

Click to read more »
File:Blue ribbon dahlias - 1926 - Blue Ridge Nursery ; E.A. Andrews ; W.T. Andrews. (IA CAT31320971).pdf
Selasa, 2025-09-23 22:22:58

Blue ribbon dahlias : 1926 / Blue Ridge Nursery ; E.A. Andrews ; W.T. Andrews.   (  ) Author Blue Ribbon Dahlia Co Andrews, E. A Andrews, W. T Henry G...

Click to read more »
File:Project Blue Book report - 1965-07-7439835-Spokane-Washington.pdf
Rabu, 2024-08-21 02:24:51

DescriptionProject Blue Book report - 1965-07-7439835-Spokane-Washington.pdf English: Project Blue Book report - 1965-07-7439835-Spokane-Washington, USA...

Click to read more »
File:Project Blue Book report - 1966-10-8285130-Laredo-Texas.pdf
Kamis, 2026-06-04 20:13:24

DescriptionProject Blue Book report - 1966-10-8285130-Laredo-Texas.pdf English: Project Blue Book report - 1966-10-8285130-Laredo-Texas, USA. Date October...

Click to read more »
File:Project Blue Book report - 1966-12-8280525-Boulder-Colorado.pdf
Minggu, 2024-08-18 12:57:45

DescriptionProject Blue Book report - 1966-12-8280525-Boulder-Colorado.pdf English: Project Blue Book report - 1966-12-8280525-Boulder-Colorado, USA....

Click to read more »
File:Project Blue Book report - 1959-07-8407543-Yakima-Bremerton-Bellingham-WashingtonArea.pdf
Selasa, 2024-08-20 16:06:50

DescriptionProject Blue Book report - 1959-07-8407543-Yakima-Bremerton-Bellingham-WashingtonArea.pdf English: Project Blue Book report -...

Click to read more »
File:Project Blue Book report - 1965-08-7473906-Pueblo-Colorado.pdf
Minggu, 2024-08-18 02:55:45

DescriptionProject Blue Book report - 1965-08-7473906-Pueblo-Colorado.pdf English: Project Blue Book report - 1965-08-7473906-Pueblo-Colorado, USA. Date...

Click to read more »
File:The blue ribbon; (IA blueribbon00kimb).pdf
Minggu, 2025-07-06 15:44:42

The blue ribbon;   (  ) Author Kimball, Arthur Reed, 1855- [from old catalog] Title The blue ribbon; Publisher New York, Dodd, Mead & company Description...

Click to read more »
File:Blue book of Brookline and Longwood (IA bluebookofbrookl1902unse).pdf
Jumat, 2025-08-29 09:46:56

Blue book of Brookline and Longwood   (  ) Title Blue book of Brookline and Longwood Volume 1902 Publisher Observer Co. Description Imprint varies: Davis...

Click to read more »
File:Project Blue Book report - 1966-05-7092177-Dobbston-Ohio.pdf
Selasa, 2024-11-05 06:07:43

DescriptionProject Blue Book report - 1966-05-7092177-Dobbston-Ohio.pdf English: Project Blue Book report - 1966-05-7092177-Dobbston-Ohio, USA. Date May...

Click to read more »
File:Project Blue Book report - 1952-01-6310548-PHILADELPHIA-PENN.pdf
Kamis, 2025-11-06 03:55:55

DescriptionProject Blue Book report - 1952-01-6310548-PHILADELPHIA-PENN.pdf English: Project Blue Book report - 1952-01-6310548-PHILADELPHIA-PENN, USA...

Click to read more »
File:Project Blue Book report - 1949-07-6310510-Galveston-Texas-406-.pdf
Minggu, 2024-08-18 06:30:57

DescriptionProject Blue Book report - 1949-07-6310510-Galveston-Texas-406-.pdf English: Project Blue Book report - 1949-07-6310510-Galveston-Texas-406-...

Click to read more »
File:Hayes seed annual, season of 1937 - everything in seed for the farm, field and garden - (special seed offer) - Hayes Seed House ; Gene Hayes, prop. (IA CAT31349273).pdf
Minggu, 2024-08-18 04:40:01

for the farm, field and garden : [special seed offer] / Hayes Seed House ; Gene Hayes, prop.   (  ) Author Hayes Produce Co Title Hayes seed annual, season...

Click to read more »
File:A bibliography of blue grouse-1889-1977 (IA IND79077231).pdf
Minggu, 2024-08-18 05:39:26

A bibliography of blue grouse--1889-1977   (  ) Author Severson, K.E Title A bibliography of blue grouse--1889-1977 Series title General technical report...

Click to read more »
File:Project Blue Book report - 1950-04-9614849-Lafayette-Ind.pdf
Minggu, 2024-08-18 21:31:37

DescriptionProject Blue Book report - 1950-04-9614849-Lafayette-Ind.pdf English: Project Blue Book report - 1950-04-9614849-Lafayette-Ind, USA. Date April...

Click to read more »
File:Blue Ridge Peony Gardens (price list). (IA CAT31329387).pdf
Selasa, 2025-09-23 20:28:35

Blue Ridge Peony Gardens [price list].   (  ) Author Blue Ridge Peony Gardens Henry G. Gilbert Nursery and Seed Trade Catalog Collection Title Blue Ridge...

Click to read more »
File:The gray and the blue. A story founded on incidents connected with the war for the union (IA graybluestoryfou00roee).pdf
Senin, 2024-09-16 03:01:10

The gray and the blue. A story founded on incidents connected with the war for the union   (  ) Author Roe, E. R. (Edward Reynolds) 1813-1893 Wilmer, Richard...

Click to read more »
File:The gray and the blue. A story founded on incidents connected with the War for the Union (IA cu31924022160547).pdf
Senin, 2024-09-16 02:58:42

and the blue. A story founded on incidents connected with the War for the Union   (  ) Author Roe, Edward Reynolds Title The gray and the blue. A story...

Click to read more »
File:Project Blue Book report - 1965-08-7464008-Laredo-Texas.pdf
Rabu, 2024-08-21 04:57:57

DescriptionProject Blue Book report - 1965-08-7464008-Laredo-Texas.pdf English: Project Blue Book report - 1965-08-7464008-Laredo-Texas, USA. Date August...

Click to read more »
File:Historical patterns of western spruce budworm and Douglas-fir tussock moth outbreaks in the northern Blue Mountains, Oregon, since A.D. 1700 (IA CAT10857011).pdf
Selasa, 2021-05-11 15:03:53

references (p. 24-27) Microfiche Subjects: Western spruce budworm; Blue Mountains (Or. and Wash.), History; Douglas-fir tussock moth, Blue Mountains (Or...

Click to read more »
File:Blue ribbon dahlias - 1927 (catalog) - Blue Ribbon Dahlia Co. ; E.A. Andrews ; W.T. Andrews. (IA CAT31323936).pdf
Selasa, 2025-09-23 22:22:59

Blue ribbon dahlias : 1927 [catalog] / Blue Ribbon Dahlia Co. ; E.A. Andrews ; W.T. Andrews.   (  ) Author Blue Ribbon Dahlia Co Andrews, E. A Andrews...

Click to read more »
File:Silvical characteristics of blue spruce (IA IND85048712).pdf
Selasa, 2026-03-17 09:29:30

Silvical characteristics of blue spruce   (  ) Author Fechner, G.H Title Silvical characteristics of blue spruce Series title General technical report...

Click to read more »
File:Project Blue Book report - 1965-08-7461254-Austin-Texas.pdf
Selasa, 2025-09-09 03:20:24

DescriptionProject Blue Book report - 1965-08-7461254-Austin-Texas.pdf English: Project Blue Book report - 1965-08-7461254-Austin-Texas, USA. Date August...

Click to read more »
File:Project Blue Book report - 1952-10-6383908-Ashiya Air Field, Japan.pdf
Minggu, 2024-08-18 22:13:15

DescriptionProject Blue Book report - 1952-10-6383908-Ashiya Air Field, Japan.pdf English: Project Blue Book report - 1952-10-6383908-Ashiya Air Field...

Click to read more »
File:Mutations in bacterial genes induce unanticipated changes in the relationship between bacterial pathogens in experimental otitis media.pdf
Sabtu, 2025-04-19 07:31:45

DescriptionMutations in bacterial genes induce unanticipated changes in the relationship between bacterial pathogens in experimental otitis media.pdf...

Click to read more »
File:Project Blue Book report - 1950-02-9613735-Alamogordo-NewMexico.pdf
Selasa, 2025-12-16 21:16:24

DescriptionProject Blue Book report - 1950-02-9613735-Alamogordo-NewMexico.pdf English: Project Blue Book report - 1950-02-9613735-Alamogordo-NewMexico...

Click to read more »
File:Hotel buyers' blue book .. (IA hotelbuyersblueb00chic).pdf
Minggu, 2026-04-12 10:09:32

Hotel buyers' blue book ..   (  ) Title Hotel buyers' blue book .. Publisher Chicago, Ill., G. E. Wolf system company Description PREMARC/SERLOC merged...

Click to read more »
File:Project Blue Book report - 1967-02-8550606-Denver-Colorado.pdf
Minggu, 2024-11-24 12:39:07

DescriptionProject Blue Book report - 1967-02-8550606-Denver-Colorado.pdf English: Project Blue Book report - 1967-02-8550606-Denver-Colorado, USA. Date...

Click to read more »
File:Whymper - Scrambles amongst the Alps.djvu
Rabu, 2026-04-01 16:06:55

were made on the Wood by H. J. Boot, C. Johnson, J. Mahoney, J. W. North, P. Skelton, W. G. Smith, and C. J. Staniland; and were Engraved by J. W. and...

Click to read more »
File:Project Blue Book report - 1967-02-9666417-SiouxCity-Iowa.pdf
Minggu, 2024-08-18 07:24:10

DescriptionProject Blue Book report - 1967-02-9666417-SiouxCity-Iowa.pdf English: Project Blue Book report - 1967-02-9666417-SiouxCity-Iowa, USA. Date...

Click to read more »
File:Project Blue Book report - 1952-10-8773352-Berlin-Germany.pdf
Senin, 2025-11-03 20:03:49

DescriptionProject Blue Book report - 1952-10-8773352-Berlin-Germany.pdf English: Project Blue Book report - xxxx-xx-8773352-Berlin, Germany. Date 19...

Click to read more »
File:Physician revenues from Blue Shield and Medicare part B in Pennsylvania (IA physicianrevenue00mark).pdf
Minggu, 2024-08-25 08:04:27

Physician revenues from Blue Shield and Medicare part B in Pennsylvania   (  ) Author Markel, Gene A Cantwell, James R Pennsylvania Blue Shield United States...

Click to read more »
File:Project Blue Book report - 1957-02-6786812-KitteryPoint-MaineEastNassau-NewYork.pdf
Minggu, 2026-03-22 04:11:50

DescriptionProject Blue Book report - 1957-02-6786812-KitteryPoint-MaineEastNassau-NewYork.pdf English: Project Blue Book report -...

Click to read more »
File:Project Blue Book report - 1956-08-7070250-Worthington-Ohio.pdf
Sabtu, 2025-05-03 09:40:09

DescriptionProject Blue Book report - 1956-08-7070250-Worthington-Ohio.pdf English: Project Blue Book report - 1956-08-7070250-Worthington-Ohio, USA....

Click to read more »
File:Project Blue Book report - 1949-06-6314888-FortDevens-Massachusetts-373-.pdf
Senin, 2024-09-16 12:00:53

DescriptionProject Blue Book report - 1949-06-6314888-FortDevens-Massachusetts-373-.pdf English: Project Blue Book report - 1949-06-6314888-FortDevens-Massachusetts-373-...

Click to read more »
File:Project Blue Book report - 1952-07-8580798-LAKELANDGA.pdf
Senin, 2025-10-20 00:10:52

DescriptionProject Blue Book report - 1952-07-8580798-LAKELANDGA.pdf English: Project Blue Book report - 1952-07-8580798-LAKELANDGA, USA. Date July 1952...

Click to read more »
File:Project Blue Book report - 1967-09-7412091-Ohio-IndianaArea.pdf
Sabtu, 2024-08-17 02:11:50

DescriptionProject Blue Book report - 1967-09-7412091-Ohio-IndianaArea.pdf English: Project Blue Book report - 1967-09-7412091-Ohio-IndianaArea, USA....

Click to read more »
File:A study of the physicians' services market in Pennsylvania - final report (IA studyofphysician00mark 1).pdf
Minggu, 2024-08-18 09:26:24

Pennsylvania : final report   (  ) Author Markel, Gene A Dudley, Laverne J Cromwell, Jerry Etnoyer, David P Bianchi, Susan Bunting Cantwell, James R United...

Click to read more »
File:Radial growth of grand fir and douglas-fir 10 years after defoliation by the douglas-fir tussock moth in the Blue Mountains outbreak (IA CAT92273027).pdf
Sabtu, 2026-01-03 08:35:11

douglas-fir 10 years after defoliation by the douglas-fir tussock moth in the Blue Mountains outbreak   (  ) Author Wickman, Boyd E. cn Pacific Northwest Research...

Click to read more »
File:Project Blue Book report - 1966-09-8292811-Dalton-Kentucky.pdf
Selasa, 2024-08-20 15:32:46

DescriptionProject Blue Book report - 1966-09-8292811-Dalton-Kentucky.pdf English: Project Blue Book report - 1966-09-8292811-Dalton-Kentucky, USA. Date...

Click to read more »
File:NTP technical report on the toxicology and carcinogenesis studies of C.I. direct blue 218 (CAS no. 28407-37-6) in F344-N rats and B6C3F́ mice (feed studies) (IA ntptechnicalrepo00nati 24).pdf
Sabtu, 2025-10-04 15:20:39

Toxicology and carcinogenicity studies of C.I. direct blue "February 1994." Includes bibliographical references (p. 69-76) Subjects: Dyes and dyeing; Carcinogenicity...

Click to read more »
File:Project Blue Book report - 1964-06-8724935-Dale-Indiana.pdf
Kamis, 2023-10-19 17:19:11

DescriptionProject Blue Book report - 1964-06-8724935-Dale-Indiana.pdf English: Project Blue Book report - 1964-06-8724935-Dale-Indiana, USA. Date June...

Click to read more »
File:Morning Face (IA cu31924021660166).pdf
Rabu, 2025-05-14 18:50:47

Morning Face   (  ) Author Stratton-Porter, Gene, 1863-1924 Title Morning Face Publisher Garden City, N.Y., Doubleday, Page & company Description The metadata...

Click to read more »
File:Plants that please - William P. Yeagle. (IA CAT31323728).pdf
Kamis, 2025-06-12 21:53:08

William P. Yeagle.   (  ) Author William P. Yeagle (Firm) Henry G. Gilbert Nursery and Seed Trade Catalog Collection Title Plants that please / William P. Yeagle...

Click to read more »
File:Across-shelf distribution of blue mussel larvae in the northern Gulf of Maine - consequences for population connectivity and a species range boundary.pdf
Senin, 2025-04-21 05:39:50

DescriptionAcross-shelf distribution of blue mussel larvae in the northern Gulf of Maine - consequences for population connectivity and a species range...

Click to read more »
File:Vorinostat Combined with DNMTi Epigenetically Controls the Proliferation of Lung Cancer Cells A549.pdf
Selasa, 2020-12-08 10:37:42

hypermethylation of the cells. We concluded that reactivating thehypermethylated genes in the A549 lung cancer cells by combining more than one drug was significantly...

Click to read more »
File:Wholesale peony list - fall 1927 - Blue Ridge Peony Gardens ; Stanley C. Rosefield, prop. (IA CAT31323937).pdf
Minggu, 2025-07-13 22:28:23

Wholesale peony list : fall 1927 / Blue Ridge Peony Gardens ; Stanley C. Rosefield, prop.   (  ) Author Blue Ridge Peony Gardens Henry G. Gilbert Nursery...

Click to read more »
File:Project Blue Book report - 1954-11-6959409-Louisville-Kentucky.pdf
Rabu, 2024-08-28 09:40:58

DescriptionProject Blue Book report - 1954-11-6959409-Louisville-Kentucky.pdf English: Project Blue Book report - 1954-11-6959409-Louisville-Kentucky,...

Click to read more »
File:On the Blue Colour of the Sky, the Polarization of Skylight, and on the Polarization of Light by Cloudy Matter Generally (IA jstor-112380).pdf
Kamis, 2021-03-11 23:53:06

On the Blue Colour of the Sky, the Polarization of Skylight, and on the Polarization of Light by Cloudy Matter Generally   (  ) Author Tyndall, John Title...

Click to read more »
File:Elucidation of immunological response and its regulatory network by P-TUFT-ALT-2 - a promising fusion protein vaccine for human lymphatic filariasis.pdf
Sabtu, 2025-12-20 04:17:03

DescriptionElucidation of immunological response and its regulatory network by P-TUFT-ALT-2 - a promising fusion protein vaccine for human lymphatic filariasis...

Click to read more »
File:Synthesis of activated carbon from biowaste of fir bark for methylene blue removal.pdf
Minggu, 2025-04-20 02:59:42

DescriptionSynthesis of activated carbon from biowaste of fir bark for methylene blue removal.pdf English: Luo, Lu; Wu, Xi; Li, Zeliang; Zhou, Yalan; Chen, Tingting;...

Click to read more »
File:Carte du nord de l'Amérique du sud avec répartition de spécimens de 3 espèces d'anguilles électriques electrophorus.png
Sabtu, 2024-02-17 10:16:22

Commons Attribution-Share Alike 4.0 truetrue English Sampling localities and gene trees for the three species of Electrophorus in the north of South America...

Click to read more »
File:Project Blue Book report - 1957-08-6968057-CambriaAFStation-Calif.pdf
Rabu, 2026-02-04 23:45:55

DescriptionProject Blue Book report - 1957-08-6968057-CambriaAFStation-Calif.pdf English: Project Blue Book report - 1957-08-6968057-CambriaAFStation-Calif...

Click to read more »
File:Project Blue Book report - 1966-03-8682871-Easthampton-NewYork.pdf
Minggu, 2025-11-02 08:15:51

DescriptionProject Blue Book report - 1966-03-8682871-Easthampton-NewYork.pdf English: Project Blue Book report - 1966-03-8682871-Easthampton-NewYork,...

Click to read more »
File:Project Blue Book report - 1957-01-6786574-Glendora-California.pdf
Sabtu, 2026-02-28 23:32:25

DescriptionProject Blue Book report - 1957-01-6786574-Glendora-California.pdf English: Project Blue Book report - 1957-01-6786574-Glendora-California,...

Click to read more »
File:Blue glads for 1932 - Hillside Gardens (IA CAT31338391).pdf
Senin, 2024-08-26 00:36:38

Blue glads for 1932 / Hillside Gardens   (  ) Author Hillside Gardens (Saint Marys, Ohio) Title Blue glads for 1932 / Hillside Gardens Series title Henry...

Click to read more »
File:Project Blue Book report - 1952-04-6312702-Wichita-Kansas.pdf
Rabu, 2024-08-21 18:05:12

DescriptionProject Blue Book report - 1952-04-6312702-Wichita-Kansas.pdf English: Project Blue Book report - 1952-04-6312702-Wichita-Kansas, USA. Date...

Click to read more »
File:Remy St. Remy, or, The boy in blue (IA remystremyorboyi00longiala).pdf
Kamis, 2025-10-09 09:36:57

Remy St. Remy, or, The boy in blue   (  ) Author Longstreet, Abby Buchanan Title Remy St. Remy, or, The boy in blue Publisher New York : James O'Kane...

Click to read more »
File:Housekeeping in the Blue grass (IA housekeepinginbl00pari).pdf
Sabtu, 2020-10-31 17:24:07

in the Blue grass   (  ) Author Paris, Ky. Southern Presbyterian church. Missionary society. [from old catalog] Title Housekeeping in the Blue grass Publisher...

Click to read more »
File:Hayes seed annual - season 1930 - everything in seed for the farm, field and garden - Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop. (IA CAT31332928).pdf
Rabu, 2025-06-18 21:09:21

Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop.   (  ) Author Hayes Produce Co Hayes, Gene Henry G. Gilbert Nursery and Seed Trade Catalog...

Click to read more »
File:Growth and behaviour of blue mussels, a re-emerging polar resident, follow a strong annual rhythm shaped by the extreme high Arctic light regime.pdf
Sabtu, 2025-04-19 05:17:38

DescriptionGrowth and behaviour of blue mussels, a re-emerging polar resident, follow a strong annual rhythm shaped by the extreme high Arctic light regime...

Click to read more »
File:Nest size is predicted by female identity and the local environment in the blue tit (Cyanistes caeruleus), but is not related to the nest size of the genetic or foster mother.pdf
Minggu, 2025-11-09 02:11:41

DescriptionNest size is predicted by female identity and the local environment in the blue tit (Cyanistes caeruleus), but is not related to the nest size of the genetic...

Click to read more »
File:Remy St. Remy, or, The boy in blue (IA remystremyorboyi00long).pdf
Jumat, 2025-05-09 02:12:06

The boy in blue   (  ) Author Longstreet, Abby Buchanan Wilmer, Richard Hooker, 1918-, former owner Title Remy St. Remy, or, The boy in blue Publisher...

Click to read more »
File:Guidelines for reducing losses of lodgepole pine to the mountain pine beetle in unmanaged stands in the Rocky Mountains (IA CAT77692087).pdf
Kamis, 2025-01-09 09:45:40

pine beetle in unmanaged stands in the Rocky Mountains   (  ) Author Amman, Gene D McGregor, Mark D Cahill, Donn B Klein, William, 1928 May 10- Title Guidelines...

Click to read more »
File:Goa and the Blue Mountains; or, Six Months of Sick Leave (IA dli.granth.107655).pdf
Rabu, 2021-04-14 02:23:36

Goa and the Blue Mountains; or, Six Months of Sick Leave   (  ) Author Burton, Richard F. Title Goa and the Blue Mountains; or, Six Months of Sick Leave...

Click to read more »
File:Project Blue Book report - 1966-04-7106166-NewCastle-Maine.pdf
Minggu, 2024-08-18 13:22:49

DescriptionProject Blue Book report - 1966-04-7106166-NewCastle-Maine.pdf English: Project Blue Book report - 1966-04-7106166-NewCastle-Maine, USA. Date...

Click to read more »
File:The blue coats, and how they lived, fought and died for the Union - with scenes and incidents in the great rebellion (IA bluecoatshowthey7226true).pdf
Kamis, 2022-08-18 12:10:22

Author Truesdale, John Title The blue coats, and how they lived, fought and died for the Union : with scenes and incidents in the great rebellion ; comprising...

Click to read more »
File:Hayes seed annual - season 1931 - everything in seed for the farm, field and garden - Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop. (IA CAT31336010).pdf
Selasa, 2026-01-27 15:17:07

the farm, field and garden / Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop.   (  ) Author Hayes Produce Co Title Hayes seed annual : season...

Click to read more »
File:The Record Changer (IA recordchanger11unse).pdf
Jumat, 2026-04-24 16:30:38

Lies Over the Ocean —Vocal (Blue-Bella) Ella Logan Acc. by Perry Botkln and his Orch. (Variety) My Hands Are Tied — FT Gene Krupa and his Orch. My Heart...

Click to read more »
File:Project Blue Book report - 1956-01-7340267-WurtsmithAFB-Michigan.pdf
Sabtu, 2024-08-17 04:49:35

DescriptionProject Blue Book report - 1956-01-7340267-WurtsmithAFB-Michigan.pdf English: Project Blue Book report - 1956-01-7340267-WurtsmithAFB-Michigan...

Click to read more »
File:The Peach RGF-GLV Signaling Peptide pCTG134 Is Involved in a Regulatory Circuit That Sustains Auxin and Ethylene Actions.pdf
Kamis, 2025-01-02 16:12:26

DescriptionThe Peach RGF-GLV Signaling Peptide pCTG134 Is Involved in a Regulatory Circuit That Sustains Auxin and Ethylene Actions.pdf English: Scientific...

Click to read more »
File:Incidence of mountain pine beetle abandoned galleries in lodgepole pine (IA incidenceofmount284amma).pdf
Sabtu, 2026-03-21 19:34:51

mountain pine beetle abandoned galleries in lodgepole pine   (  ) Author Amman, Gene D Intermountain Forest and Range Experiment Station (Ogden, Utah) United...

Click to read more »
File:Project Blue Book report - 1957-04-6788504-VinsSurCaramy-France.pdf
Rabu, 2024-08-21 17:39:53

DescriptionProject Blue Book report - 1957-04-6788504-VinsSurCaramy-France.pdf English: Project Blue Book report - 1957-04-6788504-VinsSurCaramy-France...

Click to read more »
File:Fall 1919-Spring 1920 - Blue Grass Nurseries ; H.F. Hillenmeyer & Sons. (IA CAT31304077).pdf
Rabu, 2025-11-26 17:13:16

Fall 1919-Spring 1920 / Blue Grass Nurseries ; H.F. Hillenmeyer & Sons.   (  ) Author Hillenmeyer Nurseries Henry G. Gilbert Nursery and Seed Trade Catalog...

Click to read more »
File:Book of the Royal blue (IA bookofroyalblue03balt).pdf
Kamis, 2023-12-07 00:31:00

Book of the Royal blue   (  ) Author Baltimore and Ohio railroad company. [from old catalog] Title Book of the Royal blue Volume 8 Publisher Baltimore...

Click to read more »
File:Hayes seed annual - season 1932 - everything in seed for the farm, field and garden - Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop. (IA CAT31338355).pdf
Sabtu, 2025-08-09 03:23:58

the farm, field and garden / Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop.   (  ) Author Hayes Produce Co Title Hayes seed annual : season...

Click to read more »
File:Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.pdf
Sabtu, 2025-04-19 06:26:17

cells. We detected high levels of BNT162b2 in Huh7 cells and changes in gene expression of long interspersed nuclear element-1 (LINE-1), which is an endogenous...

Click to read more »
File:Project Blue Book report - 1953-02-9553693-PortAustin-Mich.pdf
Jumat, 2026-01-02 03:38:16

DescriptionProject Blue Book report - 1953-02-9553693-PortAustin-Mich.pdf English: Project Blue Book report - 1953-02-9553693-PortAustin-Mich, USA. Date...

Click to read more »
File:OrthoMaM v10b 2019 116genera circular tree.svg
Selasa, 2025-03-25 19:24:25

English Genus-level molecular phylogeny of 116 mammals inferred from the gene tree information of 14,509 coding DNA sequences of the OrthoMaM database...

Click to read more »
File:Kanesharatnam & Benjamin 2019 ZooKeys.pdf
Rabu, 2021-11-24 06:49:46

& Benjamin 2019 ZooKeys.pdf English: Kanesharatnam, N. & Benjamin, S. P. (2019). "Multilocus genetic and morphological phylogenetic analysis reveals...

Click to read more »
File:Transcriptomics technologies - journal pcbi.1005457.pdf
Sabtu, 2025-08-23 07:01:09

, 2017. Transcriptomics technologies. PLOS Computational Biology, 13(5), p.e1005457. doi:10.1371/journal.pcbi.1005457 Author Lowe, R., Shirley, N., Bleackley...

Click to read more »
File:Project Blue Book report - 1949-08-6312431-GlenDurnie-Md.pdf
Jumat, 2025-05-23 21:04:42

DescriptionProject Blue Book report - 1949-08-6312431-GlenDurnie-Md.pdf English: Project Blue Book report - 1949-08-6312431-GlenDurnie-Md, USA. Date August...

Click to read more »
File:S41586-020-2007-4.pdf
Selasa, 2026-03-24 09:24:36

sediments, soils and the built environment. We conclude that the large gene inventories of huge phages reflect a conserved biological strategy, and that...

Click to read more »
File:Opsin transcripts of predatory diving beetles - a comparison of surface and subterranean photic niches.pdf
Sabtu, 2025-08-23 12:54:03

opsin gene class from figure 1: ciliary (brown), UV (violet), blue (blue), long wavelength (green) and outgroups (dark grey). non-visual opsin of P. nigroadumbratus...

Click to read more »
File:Project Blue Book report - 1949-10-6314672-Atlantic-Iowa.pdf
Rabu, 2024-08-21 17:46:42

DescriptionProject Blue Book report - 1949-10-6314672-Atlantic-Iowa.pdf English: Project Blue Book report - 1949-10-6314672-Atlantic-Iowa, USA. Date October...

Click to read more »
File:The Subantarctic Rayadito (Aphrastura subantarctica), a new bird species on the southernmost islands of the Americas.pdf
Rabu, 2025-05-14 00:14:59

based on mitochondrial and autosomal markers, with no evidence of current gene flow. Although further research is required to define how far divergence...

Click to read more »
File:Gene Kelly - USN.jpg
Sabtu, 2025-09-20 15:07:31

DescriptionGene Kelly - USN.jpg Gene Kelly Date between 1944 and 1946 date QS:P,+1944-00-00T00:00:00Z/8,P1319,+1944-00-00T00:00:00Z/9,P1326,+1946-00-00T00:00:00Z/9...

Click to read more »
File:Conceptual Translation of FAM227A.pdf
Kamis, 2024-11-14 01:06:24

P Q S S S A N S P S E K T S S G 1622 aggaaattctaccaccctcagtcttctagtgcaaattcacccagtgaaaaaacctcttcg A K Q N S E K S L R M Q N T A K E H H C 1 NCBI Gene...

Click to read more »
File:Targeted treatment of injured nestmates with antimicrobial compounds in an ant society.pdf
Minggu, 2025-11-30 08:13:45

Adria C. LeBoeuf, Andrei Dascalu, Douglas B. Sponsler, Fumika Azuma, Evan P. Economo, Patrice Waridel, Philipp Engel, Thomas Schmitt & Laurent Keller...

Click to read more »
File:Project Blue Book report - 1959-07-8407644-Assonet-Mass.pdf
Rabu, 2025-11-12 22:28:09

DescriptionProject Blue Book report - 1959-07-8407644-Assonet-Mass.pdf English: Project Blue Book report - 1959-07-8407644-Assonet-Mass, USA. Date July...

Click to read more »
File:Blue Ridge Baptist - organ of the Baptists of Western North Carolina (serial) (IA blueridgebaptist01west).pdf
Minggu, 2026-04-12 02:38:50

Blue Ridge Baptist : organ of the Baptists of Western North Carolina [serial]   (  ) Author Western Baptist Convention of North Carolina Title Blue Ridge...

Click to read more »
File:Project Blue Book report - 1968-01-6889215-Hawaii.pdf
Minggu, 2024-08-18 14:50:34

DescriptionProject Blue Book report - 1968-01-6889215-Hawaii.pdf English: Project Blue Book report - 1968-01-6889215-Hawaii, USA. Date January 1968 Source...

Click to read more »
File:Project Blue Book report - xxxx-xx-8773139-NiagaraFalls-N-Y.pdf
Rabu, 2024-08-21 05:27:36

DescriptionProject Blue Book report - xxxx-xx-8773139-NiagaraFalls-N-Y.pdf English: Project Blue Book report - xxxx-xx-8773139-NiagaraFalls-N-Y, USA....

Click to read more »
File:Project Blue Book report - 1968-02-6890045-Irvington-NewYork.pdf
Sabtu, 2025-05-03 01:59:58

DescriptionProject Blue Book report - 1968-02-6890045-Irvington-NewYork.pdf English: Project Blue Book report - 1968-02-6890045-Irvington-NewYork, USA...

Click to read more »
File:Project Blue Book report - 1967-09-7279630-ITHACA-NEWYORK.pdf
Rabu, 2025-12-31 18:54:52

DescriptionProject Blue Book report - 1967-09-7279630-ITHACA-NEWYORK.pdf English: Project Blue Book report - 1967-09-7279630-ITHACA-NEWYORK, USA. Date...

Click to read more »
File:Izumo1 and Juno - the evolutionary origins and coevolution of essential sperm–egg binding partners.pdf
Sabtu, 2025-04-19 06:46:31

to three Folr genes in turtles, and three in mammals. All members of the blue synteny group have been maintained in this syntenic gene cluster. Two independent...

Click to read more »
File:Scribner's Magazine Volume 78.pdf
Senin, 2025-07-21 23:11:56

the genes for blue eyes he has genes for brown. And he is pure for brown because each member of one of his pairs of chromosomes contains the gene for...

Click to read more »
File:Reverting ontogeny - rapid phenotypic plasticity of colour vision in cichlid fish.pdf
Sabtu, 2025-08-23 12:55:04

either blue or red light for 118 and 132 days (figure 1a), expression of sws2b (Scheirer–Ray– Hare test, p < 0.001), sws2a (p < 0.001), rh2b (p = 0.04)...

Click to read more »
File:Catalogue of the W. P. Wilstach collection - Memorial Hall (IA catalogueofwpwil00phil).pdf
Selasa, 2024-02-13 18:03:44

Catalogue of the W. P. Wilstach collection : Memorial Hall   (  ) Author Philadelphia Museum of Art Title Catalogue of the W. P. Wilstach collection :...

Click to read more »
File:Methylation of avpr1a in the cortex of wild prairie voles - effects of CpG position and polymorphism.pdf
Minggu, 2025-09-07 18:08:46

distance of CpG pairs within (dark blue, r = −0.14, p < 0.0001) and between gene features (light blue, r = −0.09, p < 0.0001). (b) Co-methylation between...

Click to read more »
File:TLM246.png
Rabu, 2025-04-09 14:09:14

queen in eusocial ant communities may concentrate more on self and family (blue dot, center panel) than on outreach activities (red dot, center panel) more...

Click to read more »
File:Project Blue Book report - 1955-07-6968420-Baltimore-Md.pdf
Minggu, 2024-08-18 19:18:58

DescriptionProject Blue Book report - 1955-07-6968420-Baltimore-Md.pdf English: Project Blue Book report - 1955-07-6968420-Baltimore-Md, USA. Date July...

Click to read more »
File:New insights for Drosophila GAGA factor in larvae.pdf
Senin, 2026-04-06 08:36:03

was stained with DAPI (in blue). correlation should give values close to 1.0, not shown). Nevertheless, for the few genes appearing in both assays (only...

Click to read more »
File:OrthoMaM v11a 2022 162species circular tree.svg
Kamis, 2025-11-06 05:47:44

English Genus-level molecular phylogeny of 162 mammals inferred from the gene tree information of 15,766 coding DNA sequences of the OrthoMaM database...

Click to read more »
File:The physical basis of heredity (IA physicalbasisher00morg).pdf
Jumat, 2020-11-13 17:41:29

Publisher Philadelphia, London : J.B. Lippincott Description "Literature": p. 274-300 Subjects: Heredity; Chromosomes; Chromosomes; Genetics, Medical Language...

Click to read more »
File:Project Blue Book report - 1949-07-6310075-Alexandria-Louisiana.pdf
Selasa, 2024-10-15 03:12:51

DescriptionProject Blue Book report - 1949-07-6310075-Alexandria-Louisiana.pdf English: Project Blue Book report - 1949-07-6310075-Alexandria-Louisiana...

Click to read more »
File:Simultaneous augmentation of muscle and bone by locomomimetism through calcium-PGC-1α signaling.pdf
Minggu, 2025-04-20 02:44:46

images of C2C12 cells. Myosin heavy chain (red); nuclei (blue). c mRNA expression of myogenic genes. d Secondary screening for extracted compounds enhancing...

Click to read more »
File:Project Blue Book report - 1949-08-6311994-HebgenLake-Montana.pdf
Sabtu, 2026-03-07 03:38:31

DescriptionProject Blue Book report - 1949-08-6311994-HebgenLake-Montana.pdf English: Project Blue Book report - 1949-08-6311994-HebgenLake-Montana, USA...

Click to read more »
File:Project Blue Book report - 1949-05-6310947-CampHood-Texas-328-.pdf
Minggu, 2026-06-07 06:54:10

DescriptionProject Blue Book report - 1949-05-6310947-CampHood-Texas-328-.pdf English: Project Blue Book report - 1949-05-6310947-CampHood-Texas-328-,...

Click to read more »
File:Magnetic transfection with superparamagnetic chitosan-loaded IGFBP5 nanoparticles and their in vitro biosafety.pdf
Sabtu, 2025-04-19 07:17:33

Prussian blue staining, which was the initial condition of cell transfection [41]. The toxicity of gene vectors is an important parameter of gene release...

Click to read more »
File:Blue ribbon seeds. Spring 1920 - 21st annual catalog - Wood, Stubbs & Co. Incorporated, seedsmen. (IA CAT31304971).pdf
Selasa, 2025-09-23 22:23:08

Blue ribbon seeds. Spring 1920 : 21st annual catalog / Wood, Stubbs & Co. Incorporated, seedsmen.   (  ) Author Wood, Stubbs & Co Henry G. Gilbert Nursery...

Click to read more »
File:Genome mapping research-plants - a directory of USDA and state projects in CRIS (IA CAT11107144).pdf
Sabtu, 2024-08-17 23:41:46

Publisher [Beltsville, Md.?] : The System : The Division Description iv, 368 p. ; 28 cm Cover title "Draft, working copy." "January 1990." Includes indexes...

Click to read more »
File:Project Blue Book report - 1949-03-6792671-CampHood-FortWorth-TexasArea.pdf
Sabtu, 2024-10-26 17:26:23

DescriptionProject Blue Book report - 1949-03-6792671-CampHood-FortWorth-TexasArea.pdf English: Project Blue Book report - 1949-03-6792671-CampHood-FortWorth-TexasArea...

Click to read more »
File:Project Blue Book report - 1956-02-7340563-Miami-Florida.pdf
Rabu, 2024-08-21 18:02:29

DescriptionProject Blue Book report - 1956-02-7340563-Miami-Florida.pdf English: Project Blue Book report - 1956-02-7340563-Miami-Florida, USA. Date February...

Click to read more »
File:Bowles's Universal Display of the Naval Flags of all Nations in the World.pdf
Selasa, 2025-04-01 10:56:36

General IN JoaJacpourGuinea um Angleterre Zeland tals Gener a Provinces Vries Middleburgh Blue Enfigu Union Jack du Jac d'Angleter Princes Flag de...

Click to read more »
File:Degradation and detoxification of azo dyes with recombinant ligninolytic enzymes from Aspergillus sp. with secretory overexpression in Pichia pastoris.pdf
Sabtu, 2026-04-18 18:44:04

(MnP) and lignin peroxidase (LiP), have attracted much attention in the degradation of contaminants. Genes of Lac (1827 bp), MnP (1134 bp) and LiP (1119...

Click to read more »
File:A study of the physicians' services market in Pennsylvania - final report (IA studyofphysician00mark).pdf
Senin, 2024-08-26 03:35:25

Pennsylvania : final report   (  ) Author Markel, Gene A Dudley, Laverne J Cromwell, Jerry Etnoyer, David P Bianchi, Susan Bunting Cantwell, James R United...

Click to read more »
File:Project Blue Book report - 1963-05-8655540-44N49W-Atlantic-.pdf
Rabu, 2024-08-21 00:29:29

DescriptionProject Blue Book report - 1963-05-8655540-44N49W-Atlantic-.pdf English: Project Blue Book report - 1963-05-8655540-44N49W-Atlantic-, USA....

Click to read more »
File:The angel o' Deadman (IA angelodeadman00phel).pdf
Rabu, 2025-05-07 01:57:48

finish their meal at leisure, Gene went out under the trees, and stood looking down on the wind of the street, and the clean, blue swoon of the hills beyond...

Click to read more »
File:Project Blue Book report - 1967-03-7461868-PENNSYLVANIA.pdf
Sabtu, 2024-08-17 04:52:33

DescriptionProject Blue Book report - 1967-03-7461868-PENNSYLVANIA.pdf English: Project Blue Book report - 1967-03-7461868-PENNSYLVANIA, USA. Date March...

Click to read more »
File:The Wilson bulletin (IA wilsonbulletin6319wils).pdf
Kamis, 2024-11-14 06:23:11

authors) Blue- winged Warbler would carry the genes PP, and a homozygous Golden-winged Warbler pp. 4'he first generation (Fi) hybrid, receiving a gene from...

Click to read more »
File:Comprehensive investigations revealed consistent pathophysiological alterations after vaccination with COVID-19 vaccines.pdf
Senin, 2025-04-21 08:31:25

cluster/subtype expressing the corresponding gene. c UMAP representation representing cells before (blue) and after (orange) vaccination. d Heatmap of...

Click to read more »
File:At the foot of the rainbow (IA atfootofrainbow00stra 0).pdf
Rabu, 2025-05-14 17:46:42

At the foot of the rainbow   (  ) Author Stratton-Porter, Gene, 1863-1924 Title At the foot of the rainbow Publisher [Garden City, N.Y.] Doubleday, Page...

Click to read more »
File:Project Blue Book report - 1949-05-6311104-CampHood-Texas-329-.pdf
Sabtu, 2024-08-17 04:46:52

DescriptionProject Blue Book report - 1949-05-6311104-CampHood-Texas-329-.pdf English: Project Blue Book report - 1949-05-6311104-CampHood-Texas-329-,...

Click to read more »
File:Agricultural research (IA CAT90891937078).pdf
Selasa, 2025-04-08 13:13:23

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:Project Blue Book report - 1949-07-6310338-Fairfield-SuisunAFB-California-401-.pdf
Minggu, 2024-08-18 13:41:19

DescriptionProject Blue Book report - 1949-07-6310338-Fairfield-SuisunAFB-California-401-.pdf English: Project Blue Book report - 1949-07-6310338-Fair...

Click to read more »
File:Project Blue Book report - 1956-05-6785827-Aliquippa-Pennsylvania.pdf
Sabtu, 2025-11-29 18:43:45

DescriptionProject Blue Book report - 1956-05-6785827-Aliquippa-Pennsylvania.pdf English: Project Blue Book report - 1956-05-6785827-Aliquippa-Pennsylvania...

Click to read more »
File:Genetics of Engelmann spruce (IA geneticsofengelm30fowl).pdf
Kamis, 2025-02-20 07:43:17

Genetics of Engelmann spruce   (  ) Author Fowler, D. P Roche, L United States. Forest Service Title Genetics of Engelmann spruce Series title Research...

Click to read more »
File:Adaptation of the carbamoyl-phosphate synthetase enzyme in an extremophile fish.pdf
Senin, 2025-04-21 05:39:54

temperature of 30°C, pH 9 and salt concentration of 3800 µS at the University of York. 3 royalsocietypublishing.org/journal/rsos of gene expression from...

Click to read more »
File:Movieland. (Vol. 4, Feb. 1946-Jan. 1947) (IA movielandtvtimev04unse).pdf
Kamis, 2026-02-19 11:15:23

shade shimmer with satiny Check here for Scarlet Sequin Twilight Fuchsia Blue Flame □ REGULAR $1 SIZE in beautiful all metal brass swivel case. □ I enclose...

Click to read more »
File:5′-(CGA)n sequence-assisted pH-controlled assembly of supramolecular DNA nanostructure.pdf
Senin, 2025-04-21 05:36:23

Description5′-(CGA)n sequence-assisted pH-controlled assembly of supramolecular DNA nanostructure.pdf English: Yan, Yuting; Cao, Yanwei; Xiao, Chunsheng;...

Click to read more »
File:The British Butterflies and their Transformations, New ed. (IA dli.granth.84370).pdf
Senin, 2025-01-06 12:40:28

Y M P H A L I D J E . P E E rA C B ......................................................... - 1 GENES IX .— MELITiEA. O E D E R L E E ID O P T E...

Click to read more »
File:Project Blue Book report - 1951-01-7004986-Stockton-Calif.pdf
Minggu, 2024-08-18 12:50:05

DescriptionProject Blue Book report - 1951-01-7004986-Stockton-Calif.pdf English: Project Blue Book report - 1951-01-7004986-Stockton-Calif, USA. Date...

Click to read more »
File:Good & Reese blue book for florists - spring 1932 - the Good & Reese Company, wholesale florists. (IA CAT31338219).pdf
Minggu, 2022-07-31 22:28:53

Reese blue book for florists : spring 1932 / the Good & Reese Company, wholesale florists.   (  ) Author Good & Reese Co Title Good & Reese blue book for...

Click to read more »
File:Project Blue Book report - 1955-08-6972062-NewportBeach-Calif.pdf
Jumat, 2024-10-04 19:52:38

DescriptionProject Blue Book report - 1955-08-6972062-NewportBeach-Calif.pdf English: Project Blue Book report - 1955-08-6972062-NewportBeach-Calif, USA...

Click to read more »
File:Project Blue Book report - 1959-08-8407815-Woodside-California.pdf
Minggu, 2024-08-18 15:07:52

DescriptionProject Blue Book report - 1959-08-8407815-Woodside-California.pdf English: Project Blue Book report - 1959-08-8407815-Woodside-California,...

Click to read more »
File:Project Blue Book report - 1949-07-6309961-NewOrleans-Louisiana-390-.pdf
Rabu, 2024-08-21 17:18:01

DescriptionProject Blue Book report - 1949-07-6309961-NewOrleans-Louisiana-390-.pdf English: Project Blue Book report - 1949-07-6309961-NewOrleans-Louisiana-390-...

Click to read more »
File:The blue coats and how they lived, fought and died for the Union - with scenes and incidents in the Great Rebellion comprising narratives of personal adventure, thrilling incidents (IA bluecoatshowthey00true).pdf
Kamis, 2022-08-18 12:10:22

Author Truesdale, John Title The blue coats and how they lived, fought and died for the Union : with scenes and incidents in the Great Rebellion comprising...

Click to read more »
File:Project Blue Book report - 1957-12-6966570-Glouster-Mass.pdf
Minggu, 2024-08-18 06:33:43

DescriptionProject Blue Book report - 1957-12-6966570-Glouster-Mass.pdf English: Project Blue Book report - 1957-12-6966570-Glouster-Mass, USA. Date December...

Click to read more »
File:Project Blue Book report - 1952-07-6989592-OTISAFB-MASSACHUSETTS.pdf
Minggu, 2024-08-18 12:52:15

DescriptionProject Blue Book report - 1952-07-6989592-OTISAFB-MASSACHUSETTS.pdf English: Project Blue Book report - 1952-07-6989592-OTISAFB-MASSACHUSETTS...

Click to read more »
File:Project Blue Book report - 1949-01-6792140-Jackson-Miss-233-.pdf
Sabtu, 2024-08-17 04:46:42

DescriptionProject Blue Book report - 1949-01-6792140-Jackson-Miss-233-.pdf English: Project Blue Book report - 1949-01-6792140-Jackson-Miss-233-, USA...

Click to read more »
File:Hayes seed annual - season 1926 - everything in seed for the farm, field and garden - Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop. (IA CAT31322180).pdf
Kamis, 2025-06-26 12:17:35

the farm, field and garden / Hayes Seed House, owner Hayes Produce Co. ; Gene Hayes, prop.   (  ) Author Hayes Produce Co Henry G. Gilbert Nursery and...

Click to read more »
File:Project Blue Book report - 1949-03-6792872-Honolulu-Hawaii.pdf
Sabtu, 2024-08-17 04:46:46

DescriptionProject Blue Book report - 1949-03-6792872-Honolulu-Hawaii.pdf English: Project Blue Book report - 1949-03-6792872-Honolulu-Hawaii, USA. Date...

Click to read more »
File:Interleukin 6 promotes an in vitro mineral deposition by stem cells isolated from human exfoliated deciduous teeth.pdf
Sabtu, 2025-04-19 06:25:58

Sukarawan, Waleerat; Kanjana, Kiattipan; Pavasant, Prasit; Fournier, Benjamin P. J.; Osathanon, Thanaphum (2018). "Interleukin 6 promotes an in vitro mineral...

Click to read more »
File:Circular Permutation in Proteins - journal.pcbi.1002445.pdf
Senin, 2025-04-21 08:22:25

the permutation by duplication mechanism [1]. In this model, a precursor gene first undergoes a duplication and fusion to form a large tandem repeat. Next...

Click to read more »
File:The American naturalist. (IA mobot31753002140835).pdf
Senin, 2024-09-23 10:12:44

evidence makes probable the view that a gene for more than 12 feathers, and the gene for no oil gland, and a gene for white color are linked, i. e., are...

Click to read more »
File:The histone H3K4 demethylase JARID1A directly interacts with haematopoietic transcription factor GATA1 in erythroid cells through its second PHD domain.pdf
Minggu, 2025-04-20 04:22:41

that bind to the retinoblastoma gene product. Nature 352, 251–254. (doi:10.1038/352251a0) van Oevelen C, Wang J, Asp P, Yan Q, Kaelin Jr WG, Kluger Y,...

Click to read more »
File:Housekeeping in the blue grass - a new and practical cook book - containing nearly a thousand recipes ... (IA cu31924089480259).pdf
Minggu, 2026-01-18 23:09:42

Housekeeping in the blue grass : a new and practical cook book : containing nearly a thousand recipes ...   (  ) Author Vehling, Joseph Dommers, 1879-1950...

Click to read more »
File:Project Blue Book report - 1956-08-6788928-Tarrytown-N-Y.pdf
Minggu, 2024-08-18 14:04:28

DescriptionProject Blue Book report - 1956-08-6788928-Tarrytown-N-Y.pdf English: Project Blue Book report - 1956-08-6788928-Tarrytown-N-Y, USA. Date August...

Click to read more »
File:Project Blue Book report - 1964-02-9739712-LosAngeles-Calif.pdf
Minggu, 2024-08-18 03:37:42

DescriptionProject Blue Book report - 1964-02-9739712-LosAngeles-Calif.pdf English: Project Blue Book report - 1964-02-9739712-LosAngeles-Calif, USA....

Click to read more »
File:Annual report - National Institute of Child Health and Human Development (IA annualreportnati1996natio).pdf
Selasa, 2024-08-27 00:23:39

have elongated hypocotyls under blue developmental response to blue mutagenized seeds. The mutants and HY5 genes. Since HY4 is light light. to...

Click to read more »
File:Immune priming prior to pathogen exposure sheds light on the relationship between host, microbiome and pathogen in disease.pdf
Sabtu, 2025-04-19 06:10:39

; Keith, Nicole I.; Schuler, Krysten L.; Comizzoli, Pierre; Hare, Matthew P.; Fleischer, Robert C.; Gratwicke, Brian; Bunting, Elizabeth M. (2023). "Immune...

Click to read more »
File:Project Blue Book report - 1949-05-6313284-ElPaso-Texas.pdf
Jumat, 2025-12-12 17:36:17

DescriptionProject Blue Book report - 1949-05-6313284-ElPaso-Texas.pdf English: Project Blue Book report - 1949-05-6313284-ElPaso-Texas, USA. Date May...

Click to read more »
File:Downregulation of dystroglycan glycosyltransferases LARGE2 and ISPD associate with increased mortality in clear cell renal cell carcinoma research paper.pdf
Kamis, 2026-05-07 01:15:29

glycosylation of its extracellular subunit αDG, which involves at least 13 distinct genes. Prior work has shown loss of αDG glycosylation in an assortment of carcinomas...

Click to read more »
File:Integrating human endogenous retroviruses into transcriptome-wide association studies highlights novel risk factors for major psychiatric conditions.pdf
Sabtu, 2026-05-09 00:11:35

Selvackadunco, Claire Troakes, Szi Kay Leung, Rosemary A. Bamford, Jonathan Mill, Paul F. O’Reilly, Deepak P. Srivastava, Douglas F. Nixon & Timothy R. Powell...

Click to read more »
File:Nutrient composition of forage crops - effects of genetic factors and agronomic practices (IA IND83077038).pdf
Jumat, 2025-01-03 05:18:16

gene, incundus, can remove this alkaloid and make blue lupine forage a good grazing crop and blue lupine seed a highprotein feed for swine. When blue...

Click to read more »
File:Project Blue Book report - 1949-07-6310480-Columbus-Ohio-405-.pdf
Minggu, 2024-08-18 13:24:34

DescriptionProject Blue Book report - 1949-07-6310480-Columbus-Ohio-405-.pdf English: Project Blue Book report - 1949-07-6310480-Columbus-Ohio-405-, USA...

Click to read more »
File:Annual report (IA annualreport1993nati).pdf
Kamis, 2025-07-10 12:31:33

isolating identify a "glaucoma" Patients tested with blue-on-yellow perimetry linkage studies. gene using positional cloning, followed by sequencing analysis...

Click to read more »
File:Project Blue Book report - 1966-05-7091843-Milledgeville-Ga.pdf
Minggu, 2024-08-18 12:30:16

DescriptionProject Blue Book report - 1966-05-7091843-Milledgeville-Ga.pdf English: Project Blue Book report - 1966-05-7091843-Milledgeville-Ga, USA....

Click to read more »
File:Surrey Archaeological Collections Volume 1.djvu
Kamis, 2025-10-09 10:18:38

the reason is this : gentlemen of that day, like those of the present, gene- rally got bigger round the waist as they got older ; and as you can't let...

Click to read more »
File:Scientific American - Series 1 - Volume 001 - Issue 06.pdf
Senin, 2012-01-09 09:54:54

contain, in addition to the· most interesting news of passing e vents, gene ral notices of the pro­ gress of M ec hanic al and other Bcielttific Im­...

Click to read more »
File:Battery ballads, Battery E, 145th field artillery (IA batteryballadsba00kell).pdf
Minggu, 2023-11-05 17:00:00

 ) Author Kelly, Wallace Blaine, 1895- [from old catalog] comp Childs, G. P., [from old catalog] joint comp United States. Army. 145th field artillery...

Click to read more »
File:Fruits, ornamental trees, shrubs, vines, plants. Fall 1918-Spring 1919 - Blue Grass Nurseries ; H.F. Hillenmeyer & Sons. (IA CAT31302525).pdf
Selasa, 2025-06-10 18:40:05

Fruits, ornamental trees, shrubs, vines, plants. Fall 1918-Spring 1919 / Blue Grass Nurseries ; H.F. Hillenmeyer & Sons.   (  ) Author Hillenmeyer Nurseries...

Click to read more »
File:NTP technical report on the toxicology and carcinogenesis studies of p-nitroaniline (CAS no. 100-01-6) in B6C3F́ mice (gavage studies) (IA ntptechnicalrepo00unse).pdf
Sabtu, 2025-10-04 15:20:16

p-nitroaniline (CAS no. 100-01-6) in B6C3F́ mice (gavage studies)   (  ) Title NTP technical report on the toxicology and carcinogenesis studies of p-nitroaniline...

Click to read more »
File:Project Blue Book report - 1951-09-7008807-Claremont-California.pdf
Sabtu, 2026-02-28 06:44:16

DescriptionProject Blue Book report - 1951-09-7008807-Claremont-California.pdf English: Project Blue Book report - 1951-09-7008807-Claremont-California...

Click to read more »
File:Project Blue Book report - 1954-06-8713990-NewYork-N-Y.pdf
Rabu, 2024-08-21 18:15:20

DescriptionProject Blue Book report - 1954-06-8713990-NewYork-N-Y.pdf English: Project Blue Book report - 1954-06-8713990-NewYork-N-Y, USA. Date June 1954...

Click to read more »
File:Project Blue Book report - 1965-10-8675227-Overton-Nevada.pdf
Minggu, 2024-08-18 13:34:14

DescriptionProject Blue Book report - 1965-10-8675227-Overton-Nevada.pdf English: Project Blue Book report - 1965-10-8675227-Overton-Nevada, USA. Date...

Click to read more »
File:Influence of polydimethylsiloxane substrate stiffness on corneal epithelial cells.pdf
Sabtu, 2025-04-19 06:25:09

housekeeping gene control. Fold change expression was calculated using the ΔΔCt method with TCP as control. 2.8. Western blot To evaluate the expression of pERK...

Click to read more »
File:Ring 21 and monosomy 21.pdf
Sabtu, 2026-04-11 08:34:47

Genetic Syndromes & Gene Therapy & ne Therap Ge y al of Gen urn e Jo Syndromes tic ISSN: 2157-7412 Militti et al., J Genet Syndr Gene Ther 2013, 4:11...

Click to read more »
File:Project Blue Book report - 1951-07-7007949-NewportNews-Va.pdf
Rabu, 2024-08-21 17:58:17

DescriptionProject Blue Book report - 1951-07-7007949-NewportNews-Va.pdf English: Project Blue Book report - 1951-07-7007949-NewportNews-Va, USA. Date...

Click to read more »
File:Visual adaptation and microhabitat choice in Lake Victoria cichlid fish.pdf
Sabtu, 2025-08-23 12:55:17

differ in opsin gene sequence (light-sensitive proteins in the eye; [6]) and opsin gene expression [12], and in visual response to blue and red light [9]...

Click to read more »
File:The role of climatic and geological events in generating diversity in Ethiopian grass frogs (genus Ptychadena).pdf
Minggu, 2025-04-20 04:34:06

grass frogs (genus Ptychadena).pdf English: Smith, Megan L.; Noonan, Brice P.; Colston, Timothy J. (2017). "The role of climatic and geological events...

Click to read more »
File:Project Blue Book report - 1958-01-6972409-Mankato-Kansas.pdf
Sabtu, 2024-08-17 04:50:44

DescriptionProject Blue Book report - 1958-01-6972409-Mankato-Kansas.pdf English: Project Blue Book report - 1958-01-6972409-Mankato-Kansas, USA. Date...

Click to read more »
File:Movieland. (Vol. 5, Feb. 1947-Jan. 1948) (IA movielandtvtimev05unse).pdf
Selasa, 2026-01-20 02:30:20

***•' v 's A o°r or ^ 9^p/ ^ % llHf J 4&°_ :§3M‘ ^o' ■ ,* y ^ '-,^p .■,/ ^ % :.^pi . s o_ '' s' Ko,V ^ xV ^X\jjr ^ &P ■ 0° ^ ^ » fir ^ * or '*&**...

Click to read more »
File:Blue ribbon seeds. 1917, spring catalog - field, garden and flower seeds, hardy plants, shrubs, bulbs, etc. - Wood Stubbs & Co., Inc., seedsmen. (IA CAT31300442).pdf
Selasa, 2025-06-10 18:24:07

Blue ribbon seeds. 1917, spring catalog : field, garden and flower seeds, hardy plants, shrubs, bulbs, etc. / Wood Stubbs & Co., Inc., seedsmen.   (  )...

Click to read more »
File:Elife-47682-v1.pdf
Selasa, 2024-10-08 17:00:25

nuclear protein that binds to DNA. Intriguingly, the expression of Dsup gene in human cells was observed to decrease DNA fragmentation induced by X-ray...

Click to read more »
File:Project Blue Book report - 1965-08-9370156-Lancaster-California.pdf
Senin, 2024-08-19 13:49:35

DescriptionProject Blue Book report - 1965-08-9370156-Lancaster-California.pdf English: Project Blue Book report - 1965-08-9370156-Lancaster-California...

Click to read more »
File:Project Blue Book report - 1960-09-8227380-111miEofKansasCity-Missouri.pdf
Minggu, 2024-08-18 00:46:32

DescriptionProject Blue Book report - 1960-09-8227380-111miEofKansasCity-Missouri.pdf English: Project Blue Book report - 1960-09-8227380-111miEofKansasCity-Missouri...

Click to read more »
File:Project Blue Book report - 1960-09-8231665-Janesville-Wisconsin.pdf
Rabu, 2025-11-05 10:47:22

DescriptionProject Blue Book report - 1960-09-8231665-Janesville-Wisconsin.pdf English: Project Blue Book report - 1960-09-8231665-Janesville-Wisconsin...

Click to read more »
File:Project Blue Book report - 1962-09-8725331-LosAngeles-California.pdf
Senin, 2024-08-19 01:01:53

DescriptionProject Blue Book report - 1962-09-8725331-LosAngeles-California.pdf English: Project Blue Book report - 1962-09-8725331-LosAngeles-California...

Click to read more »
File:S41598-020-59528-9.pdf
Minggu, 2020-09-06 07:25:42

fluorescent patterning, and the primary wavelengths emitted in response to blue excitation light are within the spectrum of green light. Widespread biofluorescence...

Click to read more »
File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubli2004nati).pdf
Senin, 2024-08-26 01:35:49

button. The head of NIAID’s Molecular Defenses section, Leto studies genes that control the production of one of the body’s most potent weapons for...

Click to read more »
File:Pone.0061912 - Broad Spectrum of Mimiviridae Virophage Allows Its Isolation Using a Mimivirus Reporter.pdf
Jumat, 2025-09-26 06:50:11

group A Mimiviridae can multiply easily in groups B and C and play a role in gene transfer among these virus subgroups. To isolate new virophages and their...

Click to read more »
File:Agricultural research (IA CAT90891937393).pdf
Minggu, 2024-08-18 22:55:17

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:The physical basis of heredity (IA cu31924024541892).pdf
Kamis, 2025-01-02 18:45:49

file content and naming conventions. Includes bibliographical references (p. 274-300) Subjects: Heredity Language English Publication date 1919 publication_date...

Click to read more »
File:Project Blue Book report - 1957-11-6783292-Hope-Arkansas.pdf
Minggu, 2024-08-18 13:38:14

DescriptionProject Blue Book report - 1957-11-6783292-Hope-Arkansas.pdf English: Project Blue Book report - 1957-11-6783292-Hope-Arkansas, USA. Date November...

Click to read more »
File:Project Blue Book report - 1956-07-6787274-SanBernandino-California.pdf
Minggu, 2024-08-18 06:31:19

DescriptionProject Blue Book report - 1956-07-6787274-SanBernandino-California.pdf English: Project Blue Book report - 1956-07-6787274-SanBernandino-California...

Click to read more »
File:The physical basis of heredity (IA physicalbasisofhmorg).pdf
Senin, 2025-05-05 15:57:23

heredity Publisher Philadelphia ; London : Lippincott Description "Literature": p. 274-300 Subjects: Chromosomes; Heredity; Chromosomes; Genetics, Medical Language...

Click to read more »
File:Project Blue Book report - 1955-04-6971901-MiraLoma-California.pdf
Rabu, 2024-08-21 17:34:46

DescriptionProject Blue Book report - 1955-04-6971901-MiraLoma-California.pdf English: Project Blue Book report - 1955-04-6971901-MiraLoma-California,...

Click to read more »
File:Missouri's hall of fame; lives of eminent Missourians (IA missourishalloff01shoe).pdf
Rabu, 2026-03-11 17:24:04

his duty to go to the 'Gene saw him and patting him on the shoulder gave him a quarter and sent him home to his mother. Then 'Gene and I went to the postoffice...

Click to read more »
File:S41467-019-10366-y.pdf
Jumat, 2024-07-19 17:02:00

subgenomic DNA fragments, spanning the long terminal repeats and the Gag gene, are excised in vivo, resulting in elimination of integrated proviral DNA;...

Click to read more »
File:S41586-019-1693-2.pdf
Senin, 2022-07-18 19:27:27

massive expansions of gene families punctuate the evolutionary history of green plants. Notably, we find that large expansions of gene families preceded the...

Click to read more »
File:Forestry research west (IA CAT80724881064).pdf
Jumat, 2025-12-12 04:58:47

dose of reality and the knowledge that the single dominant gene, labelled “MGR" for major gene resistance, is only a stop-gap measure and that saving the...

Click to read more »
File:Project Blue Book report - 1963-02-9316772-Winslow-Arizona.pdf
Rabu, 2024-08-21 08:13:33

DescriptionProject Blue Book report - 1963-02-9316772-Winslow-Arizona.pdf English: Project Blue Book report - 1963-02-9316772-Winslow-Arizona, USA. Date...

Click to read more »
File:Project Blue Book report - 1949-08-6311912-Biloxi-Hattiesburg-Mississippi.pdf
Minggu, 2024-08-18 05:23:22

DescriptionProject Blue Book report - 1949-08-6311912-Biloxi-Hattiesburg-Mississippi.pdf English: Project Blue Book report - 1949-08-6311912-Biloxi-H...

Click to read more »
File:Project Blue Book report - 1949-07-6311112-Mt-Hood-Oregon-416-.pdf
Minggu, 2024-08-18 12:25:30

DescriptionProject Blue Book report - 1949-07-6311112-Mt-Hood-Oregon-416-.pdf English: Project Blue Book report - 1949-07-6311112-Mt-Hood-Oregon-416-,...

Click to read more »
File:The fire bird (IA firebird00stra).pdf
Senin, 2024-05-20 09:07:47

Stratton-Porter, Gene, 1863-1924 Title The fire bird Publisher Garden City, N.Y., Toronto, Doubleday, Page & company Description Illustrated t.-p. and lining-papers...

Click to read more »
File:Added value of autoregulation and multi-step kinetics of transcription initiation.pdf
Senin, 2025-04-21 05:39:57

dictates cell-to-cell variability in gene expression. Science 346, 1533 –1536. (doi:10.1126/science.1255301) Kiviet DJ, Nghe P, Walker N, Boulineau S, Sunderlikova...

Click to read more »
File:Evidence for a genetic sex determination in Cnidaria, the Mediterranean red coral (Corallium rubrum).pdf
Minggu, 2025-04-20 05:42:29

Mitta, G.; Toulza, E.; Bonabaud, M.; Rialle, S.; Aurelle, D.; Pontarotti, P. (2017). "Evidence for a genetic sex determination in Cnidaria, the Mediterranean...

Click to read more »
File:Submicroscopic deletions of 11q24-25 in individuals without Jacobsen syndrome.pdf
Kamis, 2022-12-29 07:49:37

functions of some genes of interest. The patients' deletions are represented by red vertical lines, and the duplication of subject 1 by a blue vertical line...

Click to read more »
File:Project Blue Book report - 1965-08-7475278-Happy-Texas.pdf
Minggu, 2024-08-18 21:12:36

DescriptionProject Blue Book report - 1965-08-7475278-Happy-Texas.pdf English: Project Blue Book report - 1965-08-7475278-Happy-Texas, USA. Date August...

Click to read more »
File:Structure and phylogeography of two tropical predators, spinner (Stenella longirostris) and pantropical spotted (S. attenuata) dolphins, from SNP data.pdf
Minggu, 2025-04-20 02:54:01

among others [2]. In circumtropical reef fishes, several major barriers to gene flow help shape various patterns of population genetic structure. These barriers...

Click to read more »
File:Project Blue Book report - 1956-01-7340313-10MiSofStroud-Oklahoma.pdf
Minggu, 2024-08-18 06:26:33

DescriptionProject Blue Book report - 1956-01-7340313-10MiSofStroud-Oklahoma.pdf English: Project Blue Book report - 1956-01-7340313-10MiSofStroud-Oklahoma...

Click to read more »
File:S41586-020-2486-3.pdf
Sabtu, 2024-07-13 16:42:45

We integrated gene projections from our ‘Tool to infer Orthologs from Genome Alignments’ (TOGA) software with de novo and homology gene predictions as...

Click to read more »
File:Sex-biased avian host use by arbovirus vectors.pdf
Rabu, 2025-11-12 21:55:57

extraction and nested PCR amplification of a portion of the cytochrome b gene (383 and 296 bp) were conducted as previously described [15]. Amplicons were...

Click to read more »
File:A deterministic method for estimating free energy genetic network landscapes with applications to cell commitment and reprogramming paths.pdf
Senin, 2025-04-21 05:36:49

gene expression values. Varying the temperature changes the landscape dramatically. For low T, there is a high peak between the two attractors (blue line)...

Click to read more »
File:Suppression of the TGF-β pathway by a macrolide antibiotic decreases fibrotic responses by ocular fibroblasts in vitro.pdf
Minggu, 2025-04-20 02:58:47

Differential gene expression data were then obtained as log-fold changes contrasting the gene expression of fibrotic cells with control cells. 2.9. Gene expression...

Click to read more »
File:X-linked intellectual disability, type Nascimento.pdf
Selasa, 2023-09-19 01:46:19

protocols (FlexiGene, Qiagen, Hilden, Germany). Page 2 of 14 Devices, Sunnyvale, CA, USA). Cytochip data analysis was carried out using BlueFuse Multi software...

Click to read more »
File:A phylogenomic approach to resolving interrelationships of polyclad flatworms, with implications for life-history evolution.pdf
Senin, 2025-04-21 05:38:40

life-history evolution.pdf English: Goodheart, J.A., Collins, A.G., Cummings, M.P., Egger, B. and Rawlinson, K.A. (2023). A phylogenomic approach to resolving...

Click to read more »
File:Project Blue Book report - 1948-01-9669860-Hartford-Conn-93-.pdf
Rabu, 2024-11-06 05:24:17

DescriptionProject Blue Book report - 1948-01-9669860-Hartford-Conn-93-.pdf English: Project Blue Book report - 1948-01-9669860-Hartford-Conn-93-, USA...

Click to read more »
File:Project Blue Book report - 1957-09-7228544-WestGermanyZone.pdf
Jumat, 2024-11-15 04:35:30

DescriptionProject Blue Book report - 1957-09-7228544-WestGermanyZone.pdf English: Project Blue Book report - 1957-09-7228544-WestGermanyZone, USA. Date...

Click to read more »
File:The genome of the reef-building glass sponge Aphrocallistes vastus provides insights into silica biomineralization.pdf
Minggu, 2026-01-11 22:07:38

Jasmine L.; Guiglielmoni, Nadège; Krebs, Stefan; Blum, Helmut; Leys, Sally P.; Wörheide, Gert (2023). "The genome of the reef-building glass sponge Aphrocallistes...

Click to read more »
File:NTP technical report on the toxicology and carcinogenesis studies of C.I. Acid Red 114 (CAS no. 6459-94-5) in F344-N rats (drinking water studies) (IA ntptechnicalrepo00alde 1).pdf
Sabtu, 2025-10-04 15:19:46

15-4% water, and 1% sodium chloride" Includes bibliographical references (p. 65-71) Subjects: Carcinogenicity testing; Carcinogens; Benzidine dyes; Dyes;...

Click to read more »
File:Genes-10-00194-g005.png
Minggu, 2026-05-24 07:00:58

capsid protein genes, such as mcp, gpE and hp32 (major capsid protein), hp20, hp67, cp67; yellow, tpm (tape measure protein); blue, bpj (baseplate J...

Click to read more »
File:Phylogenetic evidence for the ancient Himalayan wolf - towards a clarification of its taxonomic status based on genetic sampling from western Nepal.pdf
Minggu, 2025-04-20 02:00:50

3787376. The Recanati-Kaplan Centre, Tubney House, Tubney OX13 5QL, UK 2 WildGenes Laboratory, Royal Zoological Society of Scotland, Edinburgh EH12 6TS, UK...

Click to read more »
File:Niclosamide loaded biodegradable chitosan nanocargoes - an in vitro study for potential application in cancer therapy.pdf
Minggu, 2025-04-20 01:32:27

in cancer therapy.pdf English: Naqvi, Saba; Mohiyuddin, Shanid; Gopinath, P. (2017). "Niclosamide loaded biodegradable chitosan nanocargoes: an in vitro...

Click to read more »
File:Project Blue Book report - 1967-10-7281358-Omaha-Nebraska.pdf
Senin, 2025-09-29 21:08:22

DescriptionProject Blue Book report - 1967-10-7281358-Omaha-Nebraska.pdf English: Project Blue Book report - 1967-10-7281358-Omaha-Nebraska, USA. Date...

Click to read more »
File:Les vieilles familles d'Yamachiche (microforme) - trois géné alogies (IA cihm 03752).pdf
Minggu, 2026-06-07 01:01:59

Les vieilles familles d'Yamachiche [microforme] : trois géné alogies   (  ) Author Desaulniers, F. L. (François Lesieur), 1850-1913 Sulte, Benjamin, 1841-1923...

Click to read more »
File:Summary of the Geology of Southern India (Continued from p. 171) (IA jstor-25207611).pdf
Sabtu, 2026-02-14 21:33:13

Southern India (Continued from p. 171)   (  ) Author Newbold Title Summary of the Geology of Southern India (Continued from p. 171) Volume 8 Publisher Journal...

Click to read more »
File:Les vieilles familles d'Yamachiche (microforme) - vingt-cinq géné alogies (IA cihm 03753).pdf
Senin, 2025-12-01 07:01:50

Les vieilles familles d'Yamachiche [microforme] : vingt-cinq géné alogies   (  ) Author Desaulniers, F. L. (François Lesieur), 1850-1913 Héroux, Omer Title...

Click to read more »
File:Project Blue Book report - 1957-07-6960412-Shiloh-Ohio.pdf
Minggu, 2024-08-18 01:07:53

DescriptionProject Blue Book report - 1957-07-6960412-Shiloh-Ohio.pdf English: Project Blue Book report - 1957-07-6960412-Shiloh-Ohio, USA. Date July 1957...

Click to read more »
File:Project Blue Book report - 1949-05-6792967-Morgantown-WestVirginia.pdf
Rabu, 2024-08-21 17:37:51

DescriptionProject Blue Book report - 1949-05-6792967-Morgantown-WestVirginia.pdf English: Project Blue Book report - 1949-05-6792967-Morgantown-WestVirginia...

Click to read more »
File:Agricultural research (IA CAT90891937413).pdf
Rabu, 2024-08-21 01:45:14

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:Project Blue Book report - 1949-05-6311772-Boise-Idaho-319-.pdf
Minggu, 2024-08-18 07:22:17

DescriptionProject Blue Book report - 1949-05-6311772-Boise-Idaho-319-.pdf English: Project Blue Book report - 1949-05-6311772-Boise-Idaho-319-, USA....

Click to read more »
File:IN THE RED- ADDRESSING THE NATION'S FINANCIAL CHALLENGES (IA gov.gpo.fdsys.CHRG-110shrg44120).pdf
Minggu, 2024-08-25 13:32:57

rel="nofollow">CHRG-110shrg44120</a> Superintendents of Documents ID: Y 4.G 74/9 Witnesses: Gene Dodaro, Acting Comptroller General, U.S. Government Accountability Office...

Click to read more »
File:Systematic polypharmacology and drug repurposing via an integrated L1000-based Connectivity Map database mining.pdf
Minggu, 2025-04-20 03:00:14

L1000FWD visualization of the drug-gene signatures. Drugs sharing similar MOA are clustered together. The red, green and blue boxes indicate the clusters of...

Click to read more »
File:Grain and forage research of the United States Department of Agriculture and cooperative agencies; a summary of current program and preliminary report of progress (IA CAT11089976003).pdf
Minggu, 2024-08-18 03:09:28

female parents . . Complementary Genes for Blue Aleurone Conclusive evidence obtained this year shows that a blue aleurone color in barley is due to...

Click to read more »
File:Project Blue Book report - 1961-08-8296259-Phoenix-Arizona.pdf
Rabu, 2026-05-20 18:17:15

DescriptionProject Blue Book report - 1961-08-8296259-Phoenix-Arizona.pdf English: Project Blue Book report - 1961-08-8296259-Phoenix-Arizona, USA. Date...

Click to read more »
File:Project Blue Book report - 1951-01-7005322-StewartAFB-N-Y.pdf
Minggu, 2024-08-18 06:27:58

DescriptionProject Blue Book report - 1951-01-7005322-StewartAFB-N-Y.pdf English: Project Blue Book report - 1951-01-7005322-StewartAFB-N-Y, USA. Date...

Click to read more »
File:Bayfield High School Yearbook 1960 - DPLA - d92e6393ee32e360c04e4568f799f070.pdf
Kamis, 2024-05-02 08:09:34

MciNTYRE A girl whose eyes are blue, whose heart is kind and love is true. Pep Club 1-2-3-4; Fine Arts 1; Chorus 1; P&G 1; Play 3-4. GEORGIA A KUGLE...

Click to read more »
File:Control mechanisms for stochastic biochemical systems via computation of reachable sets.pdf
Rabu, 2025-12-17 19:18:16

computation of reachable sets.pdf English: Lakatos, Eszter; Stumpf, Michael P. H. (2017). "Control mechanisms for stochastic biochemical systems via computation...

Click to read more »
File:Project Blue Book report - 1966-07-8291245-ErnestHarmonAFB-Canada.pdf
Rabu, 2026-03-18 23:22:01

DescriptionProject Blue Book report - 1966-07-8291245-ErnestHarmonAFB-Canada.pdf English: Project Blue Book report - 1966-07-8291245-ErnestHarmonAFB-Canada...

Click to read more »
File:Fmicb-09-01486 - A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses.pdf
Senin, 2025-11-24 03:41:17

Julien Andreani, Emeline Baptiste, Amina Oumessoum, Fábio P. Dornas, Ana Claudia dos S. P. Andrade, Eric Chabriere, Jônatas Abrahão, Anthony Levasseur...

Click to read more »
File:Wolbachia springs eternal - symbiosis in Collembola is associated with host ecology.pdf
Minggu, 2025-04-20 05:12:08

spirocauda) but evidence of ancient lateral gene transfer. J. Parasitol. 102, 312–318. (doi:10.1645/ 15-872) Ioannidis P et al. 2013 Extensively duplicated and...

Click to read more »
File:Draft genome assembly of the invasive cane toad, Rhinella marina.pdf
Jumat, 2025-09-26 20:21:54

Multitissue gene expression for predicted genes with and without annotated similarity to known genes. (A) Histograms of RNA-seq TPM for “similar” (blue) and...

Click to read more »
File:Agricultural research (IA CAT90891937175).pdf
Minggu, 2025-05-25 12:20:42

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:Variety studies in relation to Fusarium wilt of peas (IA varietystudiesin473wade).pdf
Senin, 2024-08-26 02:29:43

Caption title "Contribution from Bureau of Plant Industry." Bibliography: p. 25-26 Subjects: Peas Diseases and pests; Peas Varieties Language English...

Click to read more »
File:19q13.33→qter trisomy.pdf
Sabtu, 2024-11-09 14:10:21

Meta Gene 2 (2014) 799–806 Contents lists available at ScienceDirect Meta Gene 19q13.33→qter trisomy in a girl with intellectual impairment and seizures...

Click to read more »
File:S41467-020-15507-2.pdf
Minggu, 2026-03-29 19:12:04

metabolic genes and their cellular homologs reveals distinct clustering of viral sequences into divergent clades, indicating that these genes are virus-specific...

Click to read more »
File:Probe - newsletter for the USDA Plant Genome Research Program (IA CAT91962362008).pdf
Rabu, 2026-04-15 16:13:46

Missouri-Columbia Hormonal and Endosperm-Specific Regulation of Genes in Barley Ronald, Salmeron C. Pikaard P. Washington University The Regents Genetic Mechanisms...

Click to read more »
File:Morphogenetic mechanism of the acquisition of the dinosaur-type acetabulum.pdf
Sabtu, 2025-04-19 07:31:21

chicken mutants. Whole-mount alcian blue staining of (a) heterozygous and (b) homozygous HH36 embryos. (c–g) Gene expression analysis of cartilage, the...

Click to read more »
File:Willich, A. F. M. - The Domestic Encyclopædia (Vol. 1, 1802).djvu
Senin, 2022-01-03 08:02:23

Blood -wort, Blossom, Blow -pipe, Blowing, Blubber, Blue, Blue Bottle, Blueing, Board, Boar, Bobbing, Body, Bog', Bohea, Boilers...

Click to read more »
File:Abandoned mountain pine beetle galleries in lodgepole pine (IA abandonedmountai197amma).pdf
Minggu, 2023-07-02 17:14:48

Abandoned mountain pine beetle galleries in lodgepole pine   (  ) Author Amman, Gene D Intermountain Forest and Range Experiment Station (Ogden, Utah) United...

Click to read more »
File:Project Blue Book report - 1948-03-9670072-Smyrna-Tenn--104-.pdf
Rabu, 2024-08-21 17:44:39

DescriptionProject Blue Book report - 1948-03-9670072-Smyrna-Tenn--104-.pdf English: Project Blue Book report - 1948-03-9670072-Smyrna-Tenn--104-, USA...

Click to read more »
File:Train of Tomorrow.pdf
Selasa, 2025-08-05 00:19:20

has inspired a glittering succession of luxury trains - culminating in the blue and silve1• beauty you will read about here. And not least important, Diesel...

Click to read more »
File:RIT NandE Vol12Num31 1980 Sep25 Complete.pdf
Sabtu, 2022-02-26 02:13:48

Cross/Blue Shield/Blue Million sub­ scribers and single and family Rochester Health Network and Group Health members. Blue Cross/Blue Shield/Blue Million...

Click to read more »
File:Biophysical basis for convergent evolution of two veil-forming microbes.pdf
Senin, 2025-04-21 08:19:36

convergent evolution of two veil-forming microbes.pdf English: Petroff, Alexander P.; Pasulka, Alexis L.; Soplop, Nadine; Wu, Xiao-Lun; Libchaber, Albert (2015)...

Click to read more »
File:PLGA scaffold carrying icariin to inhibit the progression of osteoarthritis in rabbits.pdf
Selasa, 2026-05-19 06:12:58

* 5 1.0 A 6 1.2 G 7 PL * A relative gene expression (OPN/GAPDH) 1.4 8 A relative gene expression (Col-II/GAPDH) 01 A l nt ro /1 A...

Click to read more »
File:Agricultural research (IA CAT90891937417).pdf
Minggu, 2024-08-18 06:49:46

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:Edit Distance (+Glent) Learning Circle.pdf
Jumat, 2025-07-11 14:21:44

focus → –ous ○ king → king* ● Edit limits should be per-token† ○ cf gene → a gene ○ hot instagram → her instagram ○ 1949 uk → 1999 us ○ the 43 → the (...

Click to read more »
File:NTP technical report on the toxicology and carcinogenesis studies of 3,3'-dimethylbenzidine dihydrochloride (CAS no. 612-82-8) in F344-N rats (drinking water studies) (IA ntptechnicalrepo00alde).pdf
Sabtu, 2025-10-04 15:21:06

3'-dimethylbenzidine dihydrochloride.. "June 1991." Includes bibliographical references (p. 69-76) Subjects: Benzidine dyes; Carcinogenicity testing; Benzidines; Carcinogenicity...

Click to read more »
File:Optimum egg gallery densities for the mountain pine beetle in relation to lodgepole pine phloem thickness (IA optimumegggaller209amma).pdf
Sabtu, 2020-10-17 07:18:05

beetle in relation to lodgepole pine phloem thickness   (  ) Author Amman, Gene D Pace, Vincent E Title Optimum egg gallery densities for the mountain pine...

Click to read more »
File:Strategy for reducing mountain pine beetle infestations with ponderosa pine trap logs (IA strategyforreduc338amma).pdf
Minggu, 2024-08-18 21:12:01

pine beetle infestations with ponderosa pine trap logs   (  ) Author Amman, Gene D Intermountain Forest and Range Experiment Station (Ogden, Utah) United...

Click to read more »
File:A boy with developmental delay and mosaic supernumerary inv dup(5)(p15.33p15.1).pdf
Selasa, 2023-09-19 01:46:19

(CTNND2) in red), disease-causing genes discussed (orange), the extent of 5p amplification in the present patient (thick dark blue bar) and previously published...

Click to read more »
File:Trans-heteroclinic bifurcation - a novel type of catastrophic shift.pdf
Minggu, 2025-04-20 04:44:22

anomalies in replication-related genes (proto-oncogenes and tumour suppressor genes, compartment R); anomalies in genes preserving genomic stability (compartment...

Click to read more »
File:Magnetofection and isolation of DNA using polyethyleneimine functionalized magnetic iron oxide nanoparticles.pdf
Minggu, 2026-01-25 21:52:35

sample, pcDNA 3.1 (5.4 kb) having the EGFP gene was cloned in XL1-Blue E. coli. Plasmid DNA in that given XL1-Blue E. coli culture was isolated using PEI...

Click to read more »
File:University of North Carolina at Chapel Hill (IA journalofhouseof19nort 15).pdf
Jumat, 2024-01-19 05:47:18

Pitt (Part), Wilson (Part). Joe P. Tolson (D) Edgecombe Pinetops 72nd District: (1) Nash (Part), Wilson (Part). M Gene G. Arnold (R) Nash 73rd District:...

Click to read more »
File:1906117116.full.pdf
Jumat, 2026-02-06 23:56:30

Cretaceous, suggesting that evolutionary constraints may be acting on these genes. Consequently, our findings represent a striking example of convergent molecular...

Click to read more »
File:Project Blue Book report - 1964-04-8690807-Lakeview-southCarolina.pdf
Minggu, 2024-08-18 21:45:35

DescriptionProject Blue Book report - 1964-04-8690807-Lakeview-southCarolina.pdf English: Project Blue Book report - 1964-04-8690807-Lakeview-southCarolina...

Click to read more »
File:Project Blue Book report - 1958-05-7228018-Drummond-Wisconsin.pdf
Minggu, 2024-08-18 05:16:38

DescriptionProject Blue Book report - 1958-05-7228018-Drummond-Wisconsin.pdf English: Project Blue Book report - 1958-05-7228018-Drummond-Wisconsin, USA...

Click to read more »
File:Berry's blue ribbon sale of seed - 37th year, 1932 - Berry Seed Company. (IA CAT31337451).pdf
Minggu, 2024-08-18 15:06:52

Berry's blue ribbon sale of seed : 37th year, 1932 / Berry Seed Company.   (  ) Author Berry Seed Co Title Berry's blue ribbon sale of seed : 37th year...

Click to read more »
File:Project Blue Book report - 1947-07-9668976-WestTrenton-N-J.pdf
Senin, 2026-03-16 08:35:49

DescriptionProject Blue Book report - 1947-07-9668976-WestTrenton-N-J.pdf English: Project Blue Book report - 1947-07-9668976-WestTrenton-N-J, USA. Date...

Click to read more »
File:Cx26 keratitis ichthyosis deafness syndrome mutations trigger alternative splicing of Cx26 to prevent expression and cause toxicity in vitro.pdf
Sabtu, 2026-01-31 04:36:42

proportion of dead cells revealed by a trypan blue assay relative to dummy-transfected parental cells (treated with GeneJuice but no DNA). Cx26WT, its splice site...

Click to read more »
File:Albino seedlings of white spruce (IA albinoseedlingso118zasa).pdf
Sabtu, 2026-04-04 21:56:11

Description Caption title "May 1970." Includes bibliographical references (p. 4-5) Subjects: White spruce Alaska Seedlings; White spruce Language English...

Click to read more »
File:Absence of population structure across elevational gradients despite large phenotypic variation in mountain chickadees (Poecile gambeli).pdf
Senin, 2025-04-21 05:39:43

chickadees (Poecile gambeli).pdf English: Branch, Carrie L.; Jahner, Joshua P.; Kozlovsky, Dovid Y.; Parchman, Thomas L.; Pravosudov, Vladimir V. (2017)...

Click to read more »
File:Project Blue Book report - 1949-05-6313231-Elko-Nevada.pdf
Rabu, 2024-08-21 18:13:15

DescriptionProject Blue Book report - 1949-05-6313231-Elko-Nevada.pdf English: Project Blue Book report - 1949-05-6313231-Elko-Nevada, USA. Date May 1949...

Click to read more »
File:On the relations of phase separation and Hi-C maps to epigenetics.pdf
Selasa, 2026-05-12 10:06:32

heterochromatin is a cytologically visible state of heritable (epigenetic) gene repression. Current insights into compartmentalization have come from a high-throughput...

Click to read more »
File:Flanking heterozygosity influences the relative probability of different base substitutions in humans.pdf
Senin, 2025-04-21 23:52:40

centred on the mutating base, a value chosen to reflect the likely size of gene conversion events [19]. For comparison, I repeated all analyses for a 10-fold...

Click to read more »
File:Stochastic fluctuations in apoptotic threshold of tumour cells can enhance apoptosis and combat fractional killing.pdf
Kamis, 2025-10-09 18:42:17

Two gene models, where the model for gene p53 assumes that the gene is expressed in a burst manner whereas that for gene A assumes that the gene is expressed...

Click to read more »
File:A mammalian messenger RNA sex determination method from humpback whale (Megaptera novaeangliae) blubber biopsies.pdf
Senin, 2025-04-21 05:37:39

ZFX genes for sex identification in humans, cattle, sheep and goats. Biotechnology (NY) 8, 1279–1281. (doi:10.1038/nbt12901279) Berube M, Palsboll P. 1996...

Click to read more »
File:Bulletin (IA bulletin03peab).pdf
Senin, 2025-07-14 00:12:57

legs and toes apparently yellow ; bill webs darker. Apparently the genes which are responsible for many visible characters of L. cucullatus and B...

Click to read more »
File:A biomolecular proportional integral controller based on feedback regulations of protein level and activity.pdf
Senin, 2025-04-21 05:36:30

development copper (a) 7 gene repression hCtr1 (x) transporter inactivation hCtr1 copper excess (y) (b) p LHCII (x*) PSII gene repression phosphorylation...

Click to read more »
File:Project Blue Book report - 1959-08-8408429-Macon&Forsyth-Ga.pdf
Minggu, 2025-06-01 15:37:35

DescriptionProject Blue Book report - 1959-08-8408429-Macon&Forsyth-Ga.pdf English: Project Blue Book report - 1959-08-8408429-MaconfilenameForsyth-Ga...

Click to read more »
File:Sotoyoman - 1911-05 (IA cstr 000308).pdf
Rabu, 2022-07-27 05:59:24

a v e r , P r e s id e n t | ' 1 •'SA V jggs , S. H W C a s h i e ^ . ' i Carner P ow ell and Center Streets O a ^ en tfa o f . thi^ p eop le o f...

Click to read more »
File:The good, the bad and the boa- An unexpected new species of a true boa revealed by morphological and molecular evidence.pdf
Jumat, 2024-04-26 10:08:55

investigate the phylogenetic reconstruction (using mitochondrial and nuclear genes) of the genus in parallel to the detailed study of some phenotypic systems...

Click to read more »
File:Project Blue Book report - 1961-09-8302885-OsanAFB-Korea.pdf
Selasa, 2026-04-07 23:27:45

DescriptionProject Blue Book report - 1961-09-8302885-OsanAFB-Korea.pdf English: Project Blue Book report - 1961-09-8302885-OsanAFB-Korea, USA. Date September...

Click to read more »
File:Project Blue Book report - 1957-11-6782498-SWOfTokyo-Japan.pdf
Rabu, 2024-08-21 17:23:28

DescriptionProject Blue Book report - 1957-11-6782498-SWOfTokyo-Japan.pdf English: Project Blue Book report - 1957-11-6782498-SWOfTokyo-Japan, USA. Date...

Click to read more »
File:Researches, chemical and philosophical - chiefly concerning nitrous oxide, or diphlogisticated nitrous air, and its respiration (IA researcheschemic00davy).pdf
Rabu, 2026-04-01 17:01:03

St. Paul's Church-Yard, by Biggs and Cottle, Bristol Description Errata on p. [1] of last group Includes bibliographical references ESTC Subjects: Nitrous...

Click to read more »
File:Project Blue Book report - 1950-01-9613338-LosAlmos-NewMexico.pdf
Senin, 2025-02-10 17:59:49

DescriptionProject Blue Book report - 1950-01-9613338-LosAlmos-NewMexico.pdf English: Project Blue Book report - 1950-01-9613338-LosAlmos-NewMexico, USA...

Click to read more »
File:Project Blue Book report - 1949-05-6312210-FortBliss-Texas.pdf
Minggu, 2025-12-28 18:23:09

DescriptionProject Blue Book report - 1949-05-6312210-FortBliss-Texas.pdf English: Project Blue Book report - 1949-05-6312210-FortBliss-Texas, USA. Date...

Click to read more »
File:Ring chromosome 18.pdf
Selasa, 2022-12-27 01:32:53

deletion involved only the DTNA gene (http://www.ncbi.nlm.nih.gov/gene, ID: 1837; OMIM 601239) and encompassed the whole gene Fig. 1 Standard cytogenetic...

Click to read more »
File:BPISAE research activities. (IA CAT11089778015).pdf
Minggu, 2024-08-18 13:12:39

RESEARCH ACTIVITIES Harlan Offers Hew Concept of Plant Gene Centers The idea that a plant gene center is a museum of archaic types, preserved in the isolation...

Click to read more »
File:Ancestral records and portraits, a compilation from the archives of Chapter I, the Colonial Dames of America, volume 2.djvu
Senin, 2025-07-07 19:15:02

of John's will; Martha, whose will may be found in the N. E. Hist, and Geneal. Reg., 1893 ; her brother John left her £1,000 for transporting herself...

Click to read more »
File:Biofilm inhibition and pathogenicity attenuation in bacteria by Proteus mirabilis.pdf
Kamis, 2025-09-18 02:46:11

strain, Agrobacterium tumefaciens A136 (TraI-lacZ fusion (pCF218) (pCF372), which produces a blue colour in the presence of 5-bromo-4-chloro-indolyl-β-Dgalactopyranoside...

Click to read more »
File:Viruses-08-00278 - Kaumoebavirus - a New Virus That Clusters with Faustoviruses and Asfarviridae.pdf
Rabu, 2026-01-07 11:26:40

coding density of 86%, corresponding to 465 genes. Most of these genes (59%) are closely related to genes from members of the proposed order Megavirales...

Click to read more »
File:Genes-10-00194-g006.png
Minggu, 2026-05-24 07:00:58

Related to PhiH1 and PhiCh1. In: MDPI: Genes, volume 10, issue 3 (Special Issue Genetics of Halophilic Microorganisms), p.194; doi:10.3390/genes10030194 Author...

Click to read more »
File:Project Blue Book report - 1962-12-9316461-Greenfield-California.pdf
Kamis, 2025-08-21 23:22:22

DescriptionProject Blue Book report - 1962-12-9316461-Greenfield-California.pdf English: Project Blue Book report - 1962-12-9316461-Greenfield-California...

Click to read more »
File:New crop varieties (IA SER72907393010).pdf
Sabtu, 2025-08-02 12:24:46

ORCHARDGRASS Palestine Pennmead CRAMBE - p. 19 Prophet - p. - p. Pee Dee 102 FLAX - p. 18 Nored POPCORN P-216 - p. WHEATGRASS Tegmar 20 Inquiry about...

Click to read more »
File:Project Blue Book report - 1965-07-9075213-GunnesonNationalMonument-N-M.pdf
Minggu, 2024-08-18 23:02:50

DescriptionProject Blue Book report - 1965-07-9075213-GunnesonNationalMonument-N-M.pdf English: Project Blue Book report - 1965-07-9075213-GunnesonNationalMonument-N-M...

Click to read more »
File:The little story house, (IA littlestoryhouse00maso).pdf
Rabu, 2025-07-02 12:11:49

little story house, Publisher Chicago, Beckley-Cardy company Description 158 p. 20 cm Subjects: Readers (Primary) Language English Publication date 1935...

Click to read more »
File:Project Blue Book report - xxxx-xx-9078317-LasVegas-Nevada.pdf
Minggu, 2024-08-18 05:27:45

DescriptionProject Blue Book report - xxxx-xx-9078317-LasVegas-Nevada.pdf English: Project Blue Book report - xxxx-xx-9078317-LasVegas-Nevada, USA. Date...

Click to read more »
File:Project Blue Book report - 1966-01-8697772-Indianapolis-Indiana.pdf
Senin, 2025-01-13 08:58:01

DescriptionProject Blue Book report - 1966-01-8697772-Indianapolis-Indiana.pdf English: Project Blue Book report - 1966-01-8697772-Indianapolis-Indiana...

Click to read more »
File:Markovian language model of the DNA and its information content.pdf
Sabtu, 2025-04-19 07:18:16

with blue points. The SE. = n p network correctly predicts the transition of groups of words for genes. Having the TPR or Sn constant for all genes at a...

Click to read more »
File:The gang - a story of the Middle West (IA gangstoryofmiddl00bras).pdf
Minggu, 2022-06-19 21:26:15

tale of the Middle West Verso of t.p.: Published March, 1910 Colored frontispiece and black and white plates facing p. 14, 86, 118, 162, 208, 302 and 304...

Click to read more »
File:Genetics of western white pine (IA geneticsofwester12bing).pdf
Kamis, 2025-02-20 08:27:05

Published in cooperation with the Society of American Foresters Bibliography: p. 13-18 Subjects: Western white pine United States Genetics Language English...

Click to read more »
File:Piceatannol attenuates RANKL-induced osteoclast differentiation and bone resorption by suppressing MAPK, NF-κB and AKT signalling pathways and promotes Caspase3-mediated apoptosis of mature osteoclasts.pdf
Kamis, 2025-10-09 18:42:40

shown relative to the RANKL-treated control (*p , 0.05, **p , 0.01, ***p , 0.001, #p , 0.0001). specific genes. As expected, RANKL significantly induced the...

Click to read more »
File:Determining consistent prognostic biomarkers of overall survival and vascular invasion in hepatocellular carcinoma.pdf
Jumat, 2026-04-24 08:59:32

significance was reached by stage ( p ¼ 0.0018) and expression of CENPH ( p ¼ 0.0038) and CDK4 ( p ¼ 0.038). KIF18A was the only gene predicting vascular invasion...

Click to read more »
File:Viruses-13-00149-v2 - Phage phiKZ—The First of Giants.pdf
Jumat, 2025-09-26 22:17:56

lytic activity and the blue opalescence of their negative colonies, and provide a background for the search and discovery of new P. aeruginosa giant phages...

Click to read more »
File:The naturalist's miscellany - or coloured figures of natural objects; drawn and described immediately from nature (IA naturalistsmisc3shaw).pdf
Kamis, 2022-10-27 04:43:45

and E. and R. P. Nodder Only v. 1 has t.-p., but title and volume number are embodied in the dedication of each volume Special engr. t.-p. in v. 1: Vivarium...

Click to read more »
File:A novel MC1R allele for black coat colour reveals the Polynesian ancestry and hybridization patterns of Hawaiian feral pigs.pdf
Senin, 2025-04-21 05:38:33

Barnett, Ross; Fleischer, Robert C.; James, Helen F.; Duffy, Dave; Sparks, Jed P.; Clements, David R.; Andersson, Leif; Dobney, Keith; Leonard, Jennifer A...

Click to read more »
File:Genes-10-00194-g005-btm.jpg
Minggu, 2026-05-24 07:00:57

capsid protein genes, such as mcp, gpE and hp32 (major capsid protein), hp20, hp67, cp67; yellow, tpm (tape measure protein); blue, bpj (baseplate J...

Click to read more »
File:Finders-keepers;a play in one act, (IA finderskeepersap00kell).pdf
Rabu, 2024-10-30 01:14:14

play in one act, Publisher Cincinnati, Stewart Kidd Company Description 50 p. 19 cm Subjects: Language English Publication date 1923 publication_date QS:P577...

Click to read more »
File:Project Blue Book report - 1956-06-6786693-ScatteredpointsInS-CalfmLosAngelestoSanDiego.pdf
Minggu, 2024-08-25 01:15:09

DescriptionProject Blue Book report - 1956-06-6786693-ScatteredpointsInS-CalfmLosAngelestoSanDiego.pdf English: Project Blue Book report -...

Click to read more »
File:Project Blue Book report - 1950-10-9617263-Lark-Utah.pdf
Minggu, 2026-04-12 13:39:48

DescriptionProject Blue Book report - 1950-10-9617263-Lark-Utah.pdf English: Project Blue Book report - 1950-10-9617263-Lark-Utah, USA. Date October 1950...

Click to read more »
File:Special Meeting. Fourth Session, 27th May, Half Past 7 O'Clock, P. M. (IA jstor-982017).pdf
Senin, 2024-12-02 06:12:07

27th May, Half Past 7 O'Clock, P. M.   (  ) Title Special Meeting. Fourth Session, 27th May, Half Past 7 O'Clock, P. M. Volume 3 Publisher Proceedings...

Click to read more »
File:Viruses-12-00020 - Chloroviruses.pdf
Jumat, 2025-09-26 22:06:35

proteins, including many not previously seen in viruses. Examples include genes encoding DNA restriction and modification enzymes, hyaluronan and chitin...

Click to read more »
File:S41467-019-11690-z.pdf
Selasa, 2024-10-08 20:45:20

Peixoto, Cleusa Nagamachi, Leandro Sousa, Luciano F. A. Montag, Frank Ribeiro, Joseph C. Waddell, Nivaldo M. Piorsky, Richard P. Vari & Wolmar B. Wosiacki...

Click to read more »
File:Project Blue Book report - 1958-03-6964884-SeasidePark-N-J.pdf
Minggu, 2024-08-18 13:45:48

DescriptionProject Blue Book report - 1958-03-6964884-SeasidePark-N-J.pdf English: Project Blue Book report - 1958-03-6964884-SeasidePark-N-J, USA. Date...

Click to read more »
File:What varieties shall I plant?- spring 1917 - William P. Stark Nurseries. (IA CAT31300278).pdf
Selasa, 2025-06-10 18:26:18

What varieties shall I plant?: spring 1917 / William P. Stark Nurseries.   (  ) Author A. W. Steinbring (Firm) Steinbring, A. W Henry G. Gilbert Nursery...

Click to read more »
File:Reduced diversity and stability of coral-associated bacterial communities and suppressed immune function precedes disease onset in corals.pdf
Minggu, 2025-04-20 02:17:14

structures appear to overwhelm the immune system, resulting in increased immune gene expression and higher disease incidence [47]. Reports of localized increased...

Click to read more »
File:Project Blue Book report - 1954-06-8713687-GreatKills-NewYork.pdf
Senin, 2024-12-23 08:14:44

DescriptionProject Blue Book report - 1954-06-8713687-GreatKills-NewYork.pdf English: Project Blue Book report - 1954-06-8713687-GreatKills-NewYork, USA...

Click to read more »
File:S41598-019-44440-8.pdf
Minggu, 2024-07-21 07:41:49

volcanisms have created the unique Dallol hot springs, which are highly acidic (pH ~ 0) and saline (saturation) with maximum temperatures ranging between 90...

Click to read more »
File:A re-evaluation of the basicranial soft tissues and pneumaticity of the therizinosaurian Nothronychus mckinleyi (Theropoda; Maniraptora).pdf
Jumat, 2023-06-30 15:28:37

cervical vertebral (Hox) gene regulating ossification of the pneumatic sinuses. This might be a local, selectively neutral, fixed gene in the basicranium reflecting...

Click to read more »
File:Eugene Field in his home (IA cu31924021967991).pdf
Sabtu, 2026-01-10 08:09:30

Comstock Comstock, W. O Title Eugene Field in his home Publisher New York, E. P. Dutton & company Description The metadata below describe the original scanning...

Click to read more »
File:Project Blue Book report - 1951-03-7007398-PresqueIsle-Maine.pdf
Rabu, 2024-08-21 18:19:59

DescriptionProject Blue Book report - 1951-03-7007398-PresqueIsle-Maine.pdf English: Project Blue Book report - 1951-03-7007398-PresqueIsle-Maine, USA...

Click to read more »
File:Project Blue Book report - 1967-10-7281183-VandenburgAFB-California.pdf
Minggu, 2024-08-18 17:22:59

DescriptionProject Blue Book report - 1967-10-7281183-VandenburgAFB-California.pdf English: Project Blue Book report - 1967-10-7281183-VandenburgAFB-California...

Click to read more »
File:Special Meeting. Fourth Session, 27th May, Half Past 7 O'Clock, P. M (IA biostor-202040).pdf
Senin, 2024-09-23 13:05:29

27th May, Half Past 7 O'Clock, P. M   (  ) Title Special Meeting. Fourth Session, 27th May, Half Past 7 O'Clock, P. M Volume 3 Description Subjects:...

Click to read more »
File:Vegetable research of the United States Department of Agriculture and in cooperation with State Agricultural Experiment Stations; a preliminary summary of progress and plans (IA CAT11090637001).pdf
Minggu, 2024-08-18 15:20:06

linkages of the gene for Verticillium resistance with other genes suggest that the resistance gene is on the same chromosome as the lutescent gene. Further tests...

Click to read more »
File:Project Blue Book report - 1957-04-6789004-Harrow-Weald-England.pdf
Rabu, 2025-12-03 12:25:37

DescriptionProject Blue Book report - 1957-04-6789004-Harrow-Weald-England.pdf English: Project Blue Book report - 1957-04-6789004-Harrow-Weald-England...

Click to read more »
File:Soybean genetics newsletter (IA CAT75654695002).pdf
Jumat, 2025-11-14 16:34:54

tests Genes abed Sum %R SE Phase* 162-904 (w-jWm) X T235 (l/^wm) W,w, Wmwm 778 379 387 0 1544 0 R T31 (£ ln_) X 0X936 (P^n) 2 P p 2 2...

Click to read more »
File:Vigor of ponderosa pine trees surviving mountain pine beetle attack (IA IND85026140).pdf
Senin, 2025-02-03 14:41:39

William F., Gene D. Amman, and Galen C. Trostle. 1979. Mountain pine beetle. USDA Forest Service Forest Insect Disease Leaflet 2, 7 p. Wash- 1 O ...

Click to read more »
File:Biotechnology notes (IA CAT11115533045).pdf
Minggu, 2024-08-18 22:59:39

which the gene was isolated. These same techniques are being used to change the color of commercial varieties of Chrysanthemum and to develop blue roses One...

Click to read more »
File:The chemistry of health (IA chemistryofhealt00nati).pdf
Sabtu, 2025-10-04 15:20:49

Institute of General Medical Sciences Description Shipping list no.: 2001-0073-P "September 2000." Foreword -- The pathways of life -- ch 1. Actions and reactions...

Click to read more »
File:Excess labile carbon promotes diazotroph abundance in heat-stressed octocorals.pdf
Kamis, 2025-09-11 08:36:26

(b) 26°C 32°C P. flava day 0 relative nifH gene abundance (fold change) 5 R. Soc. Open Sci. 10: 221268 relative nifH gene abundance (fold change)...

Click to read more »
File:Notices and Descriptions of various New or Little Known Species of Birds (IA biostor-235461).pdf
Jumat, 2022-02-25 17:46:10

nobis, The ly moulted young. geners, a adult is and a quarter, and the con- tail Colour a light smalt-blue, three inches. the lower-parts...

Click to read more »
File:Range-wide parallel climate-associated genomic clines in Atlantic salmon.pdf
Sabtu, 2025-08-23 14:03:31

J, Loire E, Bonhomme F, David P. 2011 The coupling hypothesis: why genome scans may fail to map local adaptation genes. Mol. Ecol. 20, 2044–2072. (doi:10...

Click to read more »
File:Parasite (journal) 2013, 20, 2 Grover - HSP70.pdf
Jumat, 2025-09-19 18:59:26

Since this gene is uniquely present in P. falciparum, it is likely to be involved in aspects of host-cell remodelling, a special feature of P. falciparum...

Click to read more »
File:Tatton syndrome.pdf
Senin, 2025-12-01 06:36:05

missense variants and inframe deletions (yellow and blue lollipops) shown above the protein. Whole gene deletions and the splice site variant are not shown...

Click to read more »
File:Drosophila enhancer-Gal4 lines show ectopic expression during development.pdf
Kamis, 2026-05-14 07:12:42

GFP Wg (f) (h) (l) (p) en>Toll6 Toll6ex13 GFP DAPI Figure 3. D42 enhancer is expressed in wing cells but its gene Toll-6 is not. (a–d) Caspase...

Click to read more »
File:Project Blue Book report - 1949-05-6312057-NewOrleans.pdf
Sabtu, 2024-08-17 04:46:54

DescriptionProject Blue Book report - 1949-05-6312057-NewOrleans.pdf English: Project Blue Book report - 1949-05-6312057-NewOrleans, USA. Date May 1949...

Click to read more »
File:Patterns of pricing behavior in the Pennsylvania physician services market (IA patternsofpricin00mark).pdf
Senin, 2024-08-26 23:55:23

physician services market   (  ) Author Markel, Gene A Dudley, Laverne J Cantwell, James R Pennsylvania Blue Shield United States. Health Care Financing Administration...

Click to read more »
File:Towards population genomics in non-model species with large genomes - a case study of the marine zooplankton Calanus finmarchicus.pdf
Senin, 2026-06-08 23:32:48

optimized a capture enrichment-based protocol based on 2656 single-copy genes, yielding a total of 154 087 high-quality SNPs in C. finmarchicus including...

Click to read more »
File:Presidential Daily Diary, compiled 10-1969.pdf
Senin, 2025-05-05 00:20:19

President met ,,\'ith: Gene Boyle, Congressional Candidate for New Jerseys' 8th District Harry S. Dent, Deputy Counsel 12 :20 12 :21 P us. GOVERNMeNT PRINTING...

Click to read more »
File:Project Blue Book report - 1958-03-6963741-PanamaCanalZone.pdf
Kamis, 2025-01-09 13:01:39

DescriptionProject Blue Book report - 1958-03-6963741-PanamaCanalZone.pdf English: Project Blue Book report - 1958-03-6963741-PanamaCanalZone, USA. Date...

Click to read more »
File:Sob stuff, a volley o' sentiment (IA sobstuffvolleyos00clar).pdf
Minggu, 2026-02-08 01:41:13

'JW^f'.* ^V '^ci. •'.•. > / V* . *i.:;oL'* cLs aO" ' ^^ V "^^p^ «>!,*^'. ^.a"" ^'T'r**' <G^ ^l'Aj* ^<^ * o • t aO' ««!,V'. '^. "^...

Click to read more »
File:General Genetics.pdf
Selasa, 2020-09-22 11:50:05

Principle7 • Chi-square test8 • Founder Effect9 16.7 Glossary Gene Pool - p. 37 and p. 38 of Templeton's book 16.8 Formulas 16.8.1 Hardy Weinberg Example...

Click to read more »
File:Project Blue Book report - 1958-10-7200712-Montevideo-Uraguay.pdf
Rabu, 2025-11-12 02:04:37

DescriptionProject Blue Book report - 1958-10-7200712-Montevideo-Uraguay.pdf English: Project Blue Book report - 1958-10-7200712-Montevideo-Uraguay, USA...

Click to read more »
File:Genealogical-index to books, pamphlets, mss., etc., in the New Jersey Historical Society Library. (IA genealogicalinde00newj).pdf
Rabu, 2025-12-17 21:56:52

Jersey Historical Society Library. Publisher [Newark? N.J.] Description 45 p. 23 cm Reprinted from the "Proceedings" of the Society, April, 1923 Prepared...

Click to read more »
File:Inferring transcriptional bursting kinetics from single-cell snapshot data using a generalized telegraph model.pdf
Sabtu, 2025-04-19 06:25:05

inference, transcriptional bursting, single-cell snapshot, non-Markovian, gene expression Author for correspondence: Jiajun Zhang e-mail: zhjiajun@mail...

Click to read more »
File:The Film Daily, Jan-Dec 1925.djvu
Minggu, 2025-03-09 09:21:45

creasing the circuit to thirteen. Tbe house will be completely redecorated. "Blue" Laws Off in Waters, Okla. Waters, Okla. — The town has voted in favor...

Click to read more »
File:Ncomms15087 - Noumeavirus replication relies on a transient remote control of the host nucleus.pdf
Jumat, 2025-10-10 06:18:28

whether the gene upstream of each start codon was in the same orientation (red curve and Inset arrows) or in the reverse orientation (blue curve and inset...

Click to read more »
File:Proceedings-Symposium on Shrub Ecophysiology and Biotechnology, Logan, Utah, June 30-July 2, 1987 (IA CAT89907887).pdf
Minggu, 2025-11-30 22:19:35

Optimal distance for gene flow apparently differs between ecological generalists and specialists. The optimal pattern of gene flow is dependent upon...

Click to read more »
File:L-2L ladder digital-to-analogue converter for dynamics generation of chemical concentrations.pdf
Sabtu, 2025-04-19 06:47:49

neural activities [9]. Other studies demonstrated the temporal control of gene expression by modulating the corresponding inducer concentrations over time...

Click to read more »
File:Climate change, transgenic corn adoption and field-evolved resistance in corn earworm.pdf
Minggu, 2025-12-07 18:21:27

field-evolved resistance in corn earworm.pdf English: Venugopal, P. Dilip; Dively, Galen P. (2017). "Climate change, transgenic corn adoption and field-evolved...

Click to read more »
File:Shelterbelt establishment and growth at a windswept Wyoming rangeland site (IA CAT92273458).pdf
Jumat, 2025-08-08 17:53:13

Distributed to depository libraries in microfiche "February 1983"--T.p. verso Bibliography: p. 12 Subjects: Windbreaks, shelterbelts, etc; Wyoming; Rangelands...

Click to read more »
File:Project Blue Book report - 1958-02-6961815-GANDER-Newfoundland.pdf
Minggu, 2024-08-18 13:31:00

DescriptionProject Blue Book report - 1958-02-6961815-GANDER-Newfoundland.pdf English: Project Blue Book report - 1958-02-6961815-GANDER-Newfoundland,...

Click to read more »
File:Behavioural and transcriptional changes in post-mating females of an egg parasitoid wasp species.pdf
Rabu, 2025-09-10 16:42:34

downregulated genes in mated females, mainly involved in chitin metabolism (GO: 0006030; p ¼ 0.005), phosphoenolpyruvate carboxykinase activity (GO:0004613; p ¼ 0...

Click to read more »
File:Medical Heritage Library (IA 2542062R.nlm.nih.gov).pdf
Minggu, 2025-01-26 11:42:18

doctor of medicine   (  ) Author Barton, William P. C. (William Paul Crillon), 1786-1856 Barton, William P. C. (William Paul Crillon), 1786-1856, publisher...

Click to read more »
File:Project Blue Book report - 1960-01-6968601-Poiteres-France.pdf
Minggu, 2024-08-18 17:30:16

DescriptionProject Blue Book report - 1960-01-6968601-Poiteres-France.pdf English: Project Blue Book report - 1960-01-6968601-Poiteres-France, USA. Date...

Click to read more »
File:Yellows-resistant cabbage varieties in the Danish Ballhead-Hollander group (IA yellowsresistant776walk).pdf
Rabu, 2026-02-04 07:11:51

D.C. : U.S. Dept. of Agriculture Description Caption title Bibliography: p. 12 Subjects: Cabbage Disease and pest resistance; Cabbage yellows Control;...

Click to read more »
File:Project Blue Book report - 1966-11-8277976-Columbus-Indiana.pdf
Sabtu, 2025-10-04 23:38:25

DescriptionProject Blue Book report - 1966-11-8277976-Columbus-Indiana.pdf English: Project Blue Book report - 1966-11-8277976-Columbus-Indiana, USA....

Click to read more »
File:Induction, identification and genetics analysis of tetraploid Actinidia chinensis.pdf
Kamis, 2025-09-18 14:31:13

upregulated genes; green, downregulated genes; blue, both. (figure 7c) were chosen for RT-qPCR analysis. The results showed that the three upregulated genes still...

Click to read more »
File:The digestive systems of carnivorous plants.pdf
Minggu, 2025-04-20 03:51:57

D.G., M.F., A.F., and Q.L. acquired SEM images. M.F. performed methylene blue staining. D.G., M.F., A.F., Q.L., and K.F. provided plant photographs. C...

Click to read more »
File:Project Blue Book report - 1959-09-8410573-8MiEofStGeorge-Utah.pdf
Minggu, 2024-08-18 12:30:12

DescriptionProject Blue Book report - 1959-09-8410573-8MiEofStGeorge-Utah.pdf English: Project Blue Book report - 1959-09-8410573-8MiEofStGeorge-Utah,...

Click to read more »
File:The naturalist's miscellany - or coloured figures of natural objects; drawn and described immediately from nature (IA naturalistsmisc7shaw).pdf
Kamis, 2022-10-27 04:12:53

and E. and R. P. Nodder Only v. 1 has t.-p., but title and volume number are embodied in the dedication of each volume Special engr. t.-p. in v. 1: Vivarium...

Click to read more »
File:Combination of pre-adapted bacteriophage therapy and antibiotics for treatment of fracture-related infection due to pandrug-resistant Klebsiella pneumoniae.pdf
Senin, 2025-04-21 08:25:28

frame. In orange, genes encoding packaging and lysis-associated proteins are displayed, in yellow structural proteins and in blue DNA- and metabolism-associated...

Click to read more »
File:Project Blue Book report - 1951-02-7006888-LaddAFB-Alaska.pdf
Rabu, 2024-08-21 17:34:12

DescriptionProject Blue Book report - 1951-02-7006888-LaddAFB-Alaska.pdf English: Project Blue Book report - 1951-02-7006888-LaddAFB-Alaska, USA. Date...

Click to read more »
File:Project Blue Book report - 1949-06-6313757-GingerHill-Pennsylvania-396-.pdf
Minggu, 2024-08-18 12:53:34

DescriptionProject Blue Book report - 1949-06-6313757-GingerHill-Pennsylvania-396-.pdf English: Project Blue Book report - 1949-06-6313757-GingerHill-Pennsylvania-396-...

Click to read more »
File:Enumeration of the Species of Plants Collected by Dr. C. C. Parry, and Messrs. Elihu Hall and J. P. Harbour, during the Summer and Autumn of 1862, on and near the Rocky Mountains (IA jstor-4059746).pdf
Sabtu, 2026-01-24 08:22:01

Species of Plants Collected by Dr. C. C. Parry, and Messrs. Elihu Hall and J. P. Harbour, during the Summer and Autumn of 1862, on and near the Rocky Mountains...

Click to read more »
File:How self-organization can guide evolution.pdf
Jumat, 2025-08-15 00:56:06

evolution.pdf English: Glancy, Jonathan; Stone, James V.; Wilson, Stuart P. (2016). "How self-organization can guide evolution". Royal Society Open Science...

Click to read more »
File:Annual report (IA annualreport1994nati).pdf
Minggu, 2024-08-18 15:13:58

ND RP, mutations have been identified in the genes for rhodopsin, peripherin/RDS, rod phosphodiesterase-p subunit, and the cyclic importance of the fuU...

Click to read more »
File:Documents about Martin Luther King, Jr., Executive Order 14176, 44-jk-769 739798 01-02-part 1 of 4.pdf
Minggu, 2026-05-03 20:34:12

OVER BLUE BEARING TENNESSEE LICENSE AT - FIVE THREE FIVE ONE. IN VIEW OF THE ABOVE INFORMATION, IT WOULD APPEAR THAT THE ABOVE-MENTIONED "RAY GENE" LEFT...

Click to read more »
File:FEDLINK - United States Federal Collection (IA howhealthyaregov00unit).pdf
Minggu, 2025-11-16 08:57:32

July 14 and September 9, 1999 Publisher Washington : U.S. G.P.O. : For sale by the U.S. G.P.O., Supt. of Docs., Congressional Sales Office Description...

Click to read more »
File:The white flag (IA whiteflag00stra 0).pdf
Rabu, 2025-05-14 17:51:21

Stratton-Porter, Gene, 1863-1924 Title The white flag Publisher Garden City, N.Y., Doubleday, Page & company Description 6 p. l., 483 p. 20 cm Subjects:...

Click to read more »
File:Project Blue Book report - 1952-05-9614342--SEOfJapan-34DEG15N-139DEG30E.pdf
Minggu, 2024-11-24 12:36:07

DescriptionProject Blue Book report - 1952-05-9614342--SEOfJapan-34DEG15N-139DEG30E.pdf English: Project Blue Book report - 1952-05-9614342--SEOfJapan-34DEG15N-139DEG30E...

Click to read more »
File:Project Blue Book report - 1949-07-6309803-Alexandria-Louisiana-399-.pdf
Senin, 2026-02-16 18:54:57

DescriptionProject Blue Book report - 1949-07-6309803-Alexandria-Louisiana-399-.pdf English: Project Blue Book report - 1949-07-6309803-Alexandria-Louisiana-399-...

Click to read more »
File:A summary of current program ... and preliminary report of progress (IA CAT11090396004).pdf
Minggu, 2024-08-18 04:29:11

Research on gene - 3 - action makes use of genetic defects such as dwarfism in beef cattle and riboflavin deficiency in chickens. Blood group genes, histocompatibility...

Click to read more »
File:Transgenic fish research - update, January 1993-March 1995 (IA CAT30936041).pdf
Minggu, 2024-08-18 21:26:48

National Agricultural Library, Biotechnology Information Center Description 11 p. ; 28 cm Cover title "Prepared September 28, 1995 for the USDA Office of Agricultural...

Click to read more »
File:Movie mirror. (Vol. 2, May-Oct. 1932) (IA moviemirrorvol2m02unse).pdf
Kamis, 2025-07-03 06:43:08

Him a Platinum Blond!.Dora Albert If You Do, You’ll Never Make a Hit With Gene Raymond 46 This Oh, So “Grand Hotel’’. 48 Lupe Velez and Melvyn Douglas...

Click to read more »
File:A phylogenomic analysis of the role and timing of molecular adaptation in the aquatic transition of cetartiodactyl mammals.pdf
Senin, 2025-04-21 05:38:40

hearing genes in echolocating mammals: an emerging model of genetic convergence. Heredity 108, 480–489. (doi:10.1038/hdy.2011.119) 66. Li Y, Liu Z, Shi P, Zhang...

Click to read more »
File:Mechanistic insights into molecular evolution of species-specific differential glycosaminoglycan binding surfaces in growth-related oncogene chemokines.pdf
Selasa, 2026-03-31 21:01:22

Figure 3. (a) Posterior mean ω at each amino acid site across the GRO genes; blue, purifying selection; red, positive selection. The horizontal line represents...

Click to read more »
File:Project Blue Book report - 1955-06-6964445-KENNEWICK-WASHINGTON.pdf
Minggu, 2024-08-25 00:22:06

DescriptionProject Blue Book report - 1955-06-6964445-KENNEWICK-WASHINGTON.pdf English: Project Blue Book report - 1955-06-6964445-KENNEWICK-WASHINGTON...

Click to read more »
File:A Sketch of the Geology of Fife and the Lothians; including detailed Description of Arthur’s Seat and Pentland Hills, 2nd ed. (IA dli.granth.107368).pdf
Selasa, 2024-09-17 03:59:18

ba^lt is a bed of blue basalt, g, probably 50 feet tliick. Its texture and colour vary consid^i^j^l^llr: the lower part is gener^llly blue and comp!^(^t;...

Click to read more »
File:Predictability in evolution - Adaptation of the Bonaire anole (Anolis bonairensis) to an extreme environment.pdf
Selasa, 2023-12-05 03:01:03

P = 0.05), and none of the remaining QTs had significant differences among sites (achromatic F = 2.9 P > 0.05, green F = 0.7 P > 0.05, blue F = 2.8 P...

Click to read more »
File:The light of western stars, a romance (IA cu31924012925321).pdf
Kamis, 2023-02-23 12:36:55

GIFT OF Don Holbert UHDERGRA;'- ''J/'JE LIBRARY DATE DUE ffK [See p. 26 THE CLATTER OF HOOFS STOPPED BEFORE THE DOOR THE LIGHT OF WESTERN STARS...

Click to read more »
File:The light of western stars, a romance (IA lightofwesternst00grey 0).pdf
Sabtu, 2024-05-11 08:37:42

voice answered. “Gene Stewart,” said the cowboy. “Call Florence — quick!” Thump on a door, and Madeline heard a woman exclaim: “Gene! voices. here when...

Click to read more »
File:A rapid microwave synthesis of green-emissive carbon dots with solid-state fluorescence and pH-sensitive properties.pdf
Senin, 2025-04-21 05:38:44

synthesis of green-emissive carbon dots with solid-state fluorescence and pH-sensitive properties.pdf English: Yu, Tingting; Wang, Haijiao; Guo, Chongzheng;...

Click to read more »
File:Agricultural research (IA CAT90891937425).pdf
Selasa, 2024-08-27 23:35:23

Education Administration], U.S. Dept. of Agriculture : [Supt. of Docs., U.S. G.P.O., distributor] Description Vols. for Jan./Feb.-Nov. 1953 issued by: Agricultural...

Click to read more »
File:Early animal evolution - a morphologist's view.pdf
Rabu, 2025-12-24 13:42:04

19. 20. analysis of metazoan gene content. Mol. Biol. Evol. 36, 643–649. (doi:10.1093/molbev/ msz013) Burkhardt P, Sprecher SG. 2017 Evolutionary origin...

Click to read more »
File:Long's summer price list - select varieties of iris and peonies - J.D. Long. (IA CAT31341100).pdf
Minggu, 2024-08-18 04:51:27

base. F. same washed blue, veined maroon. 35c. BI.UE BANNER. S. light lavender-blue. F. v^'lvety deeper blue shading to pale blue at edges. $1.00. FOLIiWANG...

Click to read more »
File:Conidia of the insect pathogenic fungus, Metarhizium anisopliae, fail to adhere to mosquito larval cuticle.pdf
Senin, 2025-04-21 08:36:31

fail to adhere to mosquito larval cuticle.pdf English: Greenfield, Bethany P. J.; Lord, Alex M.; Dudley, Ed; Butt, Tariq M. (2014). "Conidia of the insect...

Click to read more »
File:Aflatoxin Elimination Workshop - (proceedings) (IA CAT11083246004).pdf
Minggu, 2024-08-18 23:08:51

University, Raleigh, NC : Flngerprlntis In "the aflR Gene and It:s Homologs Among 39 40 Members of P-K. Aspex*gi.2J,us Seotlon Fl&v± Chang^, D, Bhatnagar...

Click to read more »
File:Project Blue Book report - 1966-04-7091675-SouthMacon-Georgia.pdf
Minggu, 2024-08-18 14:27:43

DescriptionProject Blue Book report - 1966-04-7091675-SouthMacon-Georgia.pdf English: Project Blue Book report - 1966-04-7091675-SouthMacon-Georgia, USA...

Click to read more »
File:Investigations in poultry disease problems reported - R Batikowski, J Beach, P DeLay, K DeOme, W Hinshaw, E McNeil.pdf
Sabtu, 2026-01-24 08:51:09

DescriptionInvestigations in poultry disease problems reported - R Batikowski, J Beach, P DeLay, K DeOme, W Hinshaw, E McNeil.pdf English: Investigations in poultry...

Click to read more »
File:Project Blue Book report - 1949-07-6310204-Dayton-Ohio-387-.pdf
Minggu, 2024-08-18 12:48:50

DescriptionProject Blue Book report - 1949-07-6310204-Dayton-Ohio-387-.pdf English: Project Blue Book report - 1949-07-6310204-Dayton-Ohio-387-, USA....

Click to read more »
File:Food & nutrition research briefs (IA CAT89927079017).pdf
Selasa, 2026-01-13 08:40:29

have been licensed to use gene that stops plant ripening.—p. 3 • A gout medication stomps out cockroaches in four to six weeks.—p. 4 • Boosting your vitamin...

Click to read more »
File:Proceedings - Symposium on the Management of Lodgepole Pine to Minimize Losses to the Mountain Pine Beetle - Kalispell, MT, July 12-14, 1988 (IA CAT90949101).pdf
Kamis, 2025-12-25 04:56:15

Minimize Losses to the Mountain Pine Beetle (1988 : Kalispell, Mont.) Amman, Gene D Intermountain Research Station (Ogden, Utah) Soceity of American Foresters...

Click to read more »
File:Project Blue Book report - 1949-02-6792516-12Deg30N-81Deg10WCarribean-253-.pdf
Minggu, 2024-11-24 12:35:52

DescriptionProject Blue Book report - 1949-02-6792516-12Deg30N-81Deg10WCarribean-253-.pdf English: Project Blue Book report - 1949-02-6792516-12Deg30N...

Click to read more »
File:Project Blue Book report - 1955-05-6961634-Baltimore-Maryland.pdf
Kamis, 2025-09-11 15:25:36

DescriptionProject Blue Book report - 1955-05-6961634-Baltimore-Maryland.pdf English: Project Blue Book report - 1955-05-6961634-Baltimore-Maryland, USA...

Click to read more »
File:Flowers worthwhile are the flowers that smile in the garden of John H. Neeley, 1922-23. (IA CAT31310621).pdf
Selasa, 2025-06-10 19:37:12

Etta Lama nine Eugene Bigot La Perle La Rosiere Phi gene V'erdier Phi genie Verdier P^vangeline Phichaniment Shavlor Ph Evening Glow .1 . Exquisite...

Click to read more »
File:Wikipedia Animal Models.pdf
Minggu, 2020-10-04 22:46:41

(marked with blue arrows). Red circles indicate transcriptional node points and red rectangles highlight representative downstream target genes that were...

Click to read more »
File:Fred P. Burr & Co.'s price list - vegetable seeds flower and field seeds, bulbs, etc (IA fredpburrcospric1896fred).pdf
Minggu, 2025-08-03 19:30:17

Fred P. Burr & Co.'s price list : vegetable seeds flower and field seeds, bulbs, etc   (  ) Author Fred P. Burr & Co Henry G. Gilbert Nursery and Seed...

Click to read more »
File:Project Blue Book report - 1948-04-9670364-Montgomery-Ala-113-.pdf
Rabu, 2026-04-01 21:25:46

DescriptionProject Blue Book report - 1948-04-9670364-Montgomery-Ala-113-.pdf English: Project Blue Book report - 1948-04-9670364-Montgomery-Ala-113-,...

Click to read more »
File:Materials research with neutrons at NIST (IA jresv106n1p187).pdf
Sabtu, 2025-08-09 14:10:29

some genes are used to make RNA in very large quantities while other genes are not transcribed at all. In other words, a specific set of genes may be...

Click to read more »
File:Researches chemical and philosophical- chiefly concerning nitrous oxide or dephlogisticated nitrous air and its respiration (IA b22039703).pdf
Rabu, 2026-04-01 16:55:21

6. Mifcellaneous Obfervations - - 209 7. Recapitulation - - 211 gene - 8. "Produftioii of Nitrous Oxide from Metallic Solutions 213 9. Additional...

Click to read more »
File:A description of, and critical remarks on the picture of Christ healing the sick in the Temple - painted by Benjamin West ... and presented by him to the Pennsylvania Hospital (IA 2568043R.nlm.nih.gov).pdf
Senin, 2025-02-10 11:18:26

introduction on p. [3] ends "to arrive"; the description of the lunatic boy appears on p. 13-14, and that of the two persons carrying the sick man on p. 14-15;...

Click to read more »
File:Cleaner fish escape salmon farms and hybridize with local wrasse populations.pdf
Minggu, 2025-12-07 04:32:45

royalsocietypublishing.org Research Cite this article: Faust E, Halvorsen KT, Andersen P, Knutsen H, André C. 2018 Cleaner fish escape salmon farms and hybridize with...

Click to read more »
File:NTP technical report on the toxicology and carcinogenesis studies of 3,3'-dimethoxybenzidine dihydrochloride (CAS no. 20325-40-0) in F344-N rats (drinking water studies) (IA ntptechnicalrepo00morg).pdf
Sabtu, 2025-10-04 15:21:10

Study scientist." "January 1990." Includes bibliographical references : p. 63-70 Subjects: Benzidine dyes; Carcinogenicity testing Language English...

Click to read more »
File:A summary of current program ... and preliminary report of progress (IA CAT11090396003).pdf
Senin, 2024-08-26 01:26:29

of trypan blue dye bound by the uterine tissue. H2O, ion, and trypan blue concentrations increased in response to estrogen. The trypan blue changes qualitatively...

Click to read more »
File:Project Blue Book report - 1951-10-7011175-St-CroixFalls-Wisconsin.pdf
Rabu, 2026-05-13 22:05:58

DescriptionProject Blue Book report - 1951-10-7011175-St-CroixFalls-Wisconsin.pdf English: Project Blue Book report - 1951-10-7011175-St-CroixFalls-Wisconsin...

Click to read more »
File:Charles O'Malley - the Irish Dragoon (IA charlesomalley00leveiala).pdf
Senin, 2025-06-23 04:42:58

roundness of womanhood while her gay and sprightly manner indicated all the sans gene which only very young girls possess, and which, when tempered with perfect...

Click to read more »
File:EUD 2007-364.pdf
Kamis, 2026-05-28 14:16:21

from a snapdragon gene encoding chalcone synthase, petunia flavonoid 3’5’ hydroxylase (F3’5’H) cDNA, the terminator from the petunia gene encoding a phospholipid...

Click to read more »
File:Source data evaluation - study of factors related to physicians' prices (IA sourcedataevalua00mark).pdf
Rabu, 2026-04-08 00:40:31

prices   (  ) Author Markel, Gene A Geyer, Susan United States. Health Care Financing Administration Pennsylvania Blue Shield Title Source data evaluation :...

Click to read more »
File:Selected speeches and news releases - United States Department of Agriculture, Office of Public Affairs. (IA CAT10655231016).pdf
Selasa, 2024-08-20 23:14:13

at 3 p.m. EDT. The next scheduled price announcement will be made May 15 at 3 p.m. EDT, although prices may be announced sooner if warranted. Gene Rosera...

Click to read more »
File:Project Blue Book report - 1958-04-6967843-Jutland-Denmark.pdf
Senin, 2025-05-12 02:59:55

DescriptionProject Blue Book report - 1958-04-6967843-Jutland-Denmark.pdf English: Project Blue Book report - 1958-04-6967843-Jutland-Denmark, USA. Date...

Click to read more »
File:S41467-021-24528-4.pdf
Rabu, 2021-08-04 23:01:08

exceptionally GC-poor genome. Changes in copy number and/or expression of gene families and transcription factors (e.g. R2R3MYB, SAUR) controlling cell...

Click to read more »
File:Uniparental Disomy and Imprinting Disorders.pdf
Minggu, 2024-12-08 12:24:13

Yoshida W, Lapunzina P, et al. Methylation screening of reciprocal genome-wide UPDs identifies novel human-specific imprinted genes. Hum Mol Genet. 2011;...

Click to read more »
File:Berry's blue ribbon sale of seed - 38th year, 1933 - Berry Seed Company. (IA CAT31340123).pdf
Minggu, 2024-08-18 12:43:56

Berry's blue ribbon sale of seed : 38th year, 1933 / Berry Seed Company.   (  ) Author Berry Seed Co Title Berry's blue ribbon sale of seed : 38th year...

Click to read more »
File:September 25th; Description of a New Species of Astroscopus, Brev., in the Museum of the Academy of Natural Sciences of Philadelphia (IA jstor-4059381).pdf
Minggu, 2025-02-23 17:39:23

cleavage planes. Between these plates of granite lie plates of unchanged dark blue sandstone; a rock which at the cascades (two miles from the house in allother...

Click to read more »
File:S41467-018-07335-2.pdf
Senin, 2026-05-25 06:28:54

genome. From outside to inside: Blue filled circles depict location of encoded tRNAs. The second ring displays positions of genes (gray) either on the minus...

Click to read more »
File:Colour plasticity in response to social context and parasitic infection in a self-fertilizing fish.pdf
Sabtu, 2025-12-13 12:54:06

1098/ rspb.2005.3396) Barribeau SM, Sadd BM, Plessis L, Schmid-Hempel P. 2014 Gene expression differences underlying genotype-by-genotype specificity in...

Click to read more »
File:The Size of the Mind and the Individual.png
Kamis, 2024-09-05 22:53:53

variation in the area of prefrontal cortex allocated to the social mind (BA9, blue) and the abstract mind (BA46, green) in five different adult humans. author...

Click to read more »
File:Surgery from an osteopathic standpoint - by F. P. Young, collaborated by Charles E. Still (IA surgeryfromosteo00youn).pdf
Jumat, 2025-12-12 00:06:09

Surgery from an osteopathic standpoint / by F. P. Young, collaborated by Charles E. Still   (  ) Author Young, Frank Philip, 1870- Still, Charles E.,...

Click to read more »
File:Effects of capsaicin-induced sensory denervation on early implant osseointegration in adult rats.pdf
Minggu, 2025-04-20 05:25:43

Konttinen YT, Santavirta S, Paavolainen P, Gu X-H, Terenghi G, Polak JM. 1993 Rapid proliferation of calcitonin gene-related peptide-immunoreactive nerves...

Click to read more »
File:Long's fall garden book, 1934 - J.D. Long Seed Company. (IA CAT31343404).pdf
Rabu, 2024-08-28 02:52:45

Capitan stance light blue. P, deeper blue, edges .75 lighter RIllO Vplvot Rich deep blue of heavy substance, sug¬ gesting dark blue velvet. One of the...

Click to read more »
File:Gladiolus bulbs retail price list - Humphrey's Flower Gardens ; John B. Humphre. (IA CAT31322367).pdf
Jumat, 2025-06-13 02:14:54

GLADIOLI or Lincoln red, very fine ....$ Tiplady— Orange Salmon, Prim P Ali—Blue, small blotch of yellow in throat A1 Shira —Dark wine red, almost black...

Click to read more »
File:A comparison of radiographic and bark-removal methods for sampling of mountain pine beetle populations (IA comparisonofradi151amma).pdf
Kamis, 2025-01-02 17:39:43

  Author Amman, Gene D. cn Rasmussen, Lynn A. cn Intermountain Forest and Range Experiment Station (Ogden, Utah) 1n Title A comparison of radiographic...

Click to read more »
File:Project Blue Book report - 1949-04-6793236-DesMoines-Iowa-317-.pdf
Rabu, 2025-09-10 08:28:39

DescriptionProject Blue Book report - 1949-04-6793236-DesMoines-Iowa-317-.pdf English: Project Blue Book report - 1949-04-6793236-DesMoines-Iowa-317-,...

Click to read more »
File:Cycle and flow trusses in directed networks.pdf
Senin, 2025-04-21 08:53:11

Associative Thesaurus (http://vlado.fmf.uni-lj.si/pub/networks/data/); the gene regulatory networks (http://info.gersteinlab.org/Hierarchy); the Caenorhabditis...

Click to read more »
File:The activity of the aryl hydrocarbon receptor in T cells tunes the gut microenvironment to sustain autoimmunity and neuroinflammation.pdf
Minggu, 2025-04-20 03:45:26

test on total scores reported in legend [p = 0.0096] and on single days reported on plot) (E) Luxol fast blue with hematoxylin/eosin stain at the peak...

Click to read more »
File:S41598-019-44038-0.pdf
Sabtu, 2023-01-07 03:18:39

Janke, A. Whole-genome sequencing of the blue whale and other rorquals finds signatures for introgressive gene flow. Science Advances 4, eaap9873 (2018)...

Click to read more »
File:Athapaskan clothing and related objects in the collections of Field Museum of Natural History (IA athapaskanclothi04vanst).pdf
Kamis, 2025-01-02 04:08:33

edition or translation  Description Includes bibliographical references (p. 31-33) Fieldiana series has been published as Anthropological Series by Field...

Click to read more »