Search Results: File:Antisense small RNA identification using RNA Array.jpeg
Sorry, the article you're looking for isn't specifically available. Here are related topics:
File:Polaritaet antisense.png
Selasa, 2022-03-29 22:26:2615:31 Gleiberg 1666×843× (429605 bytes) ({{Information |Description= antisense (-)-Polarität einer viralen Nukleinsäure |Source= selbst gezeichnet |Date=...
Click to read more »_und_der_Read-Through-Therapie.webp){kind=link}
File:Prinzipien der Antisense-Oligonukleotid-Technologie (ASO-Technologie) und der Read-Through-Therapie.webp
Senin, 2021-01-25 11:24:534.0 Creative Commons Attribution 4.0 truetrue English Prinzipien der Antisense-Oligonukleotid-Technologie (ASO-Technologie) und der Read-Through-Therapie...
Click to read more »File:Annual report - National Heart, Lung, and Blood Institute (IA annualreportnati19872nat).pdf
Selasa, 2024-08-27 23:35:30producing the antisense transcript constitutively will be analyzed. 3. Major Findings 3T3 stable transformants containing antisense -fos or antisense -myc vectors...
Click to read more »File:RNA-directed epigenetic silencing of Periostin inhibits cell motility.pdf
Minggu, 2025-04-20 02:26:06inhibition of cell motility. We find here that promoter-directed small antisense non-coding RNAs can induce transcriptional gene silencing of Periostin...
Click to read more »File:News releases and other news material - United States Department of Agriculture, Office of Public Affairs. (IA CAT10619378001).pdf
Jumat, 2026-03-13 20:37:02plant virus to create an antisense gene," said John Hammond of USDA's Agricul¬ tural Research Service. "We inserted this antisense gene in some experimental...
Click to read more »File:Annual report - National Institute of Child Health and Human Development (IA annualrep1985nati).pdf
Minggu, 2024-08-25 02:26:27-function mutations in predetermined genes of the mouse using "antisense" RNA as a antisense RNA is able to interfere with the negative regulator. In E....
Click to read more »
File:Images large sb0c00603 0001.jpg
Senin, 2025-07-07 00:19:29org/licenses/by/4.0CC BY 4.0 Creative Commons Attribution 4.0 truetrue English Antisense small RNA identification using RNA Array. determination method or standard:...
Click to read more »File:Biotechnology notes (IA CAT11115533044).pdf
Kamis, 2023-11-23 21:15:50of $20 billion. -2- ANTISENSE MAKES SENSE TO PATENT OFFICE Calgene Inc. was issued a patent April 22 for the use of antisense technology in plants which...
Click to read more »File:1992 in vitro culture and horticultural breeding, June 28-July 2, 1992, Lord Baltimore Hotel, Inner Harbor, Baltimore, Maryland - program and abstracts (IA CAT93501640).pdf
Minggu, 2024-08-18 01:36:00embryo electrophoresis R.J. Griesbach .0:50 Transgenic coat protein and antisense RNA resistance to bean yellow mosaic potyvirus J.J. Hammond* and K.K...
Click to read more »File:Recombinant DNA research - documents relating to "NIH guidelines for research involving recombinant DNA molecules" v.20 1995 (IA recombinantdnare00nati 2).pdf
Sabtu, 2025-10-04 15:20:54Infection with BreastTargeted Retroviral Vectors Expressing Antisense c-fos or Antisense omyc RNA to the Recombinant DNA Advisory Committee for formal...
Click to read more »File:SiRNA mechanism.pdf
Minggu, 2024-04-28 18:43:343 O 3-OH (Antisense strand) 2 OH Ribose m7G mRNA-RISC complex mRNA-Degradation 5-P 3-OH 5-P 3-OH AAAAAAAA Antisense - cognate sequence...
Click to read more »File:Farm broadcasters letter (IA CAT82764458399).pdf
Minggu, 2024-08-18 12:49:24years, and the effort can require decades. USDA scientists have used an antisense gene to produce resistance to bean yellow mosaic virus. It could protect...
Click to read more »File:Annual report - National Heart, Lung, and Blood Institute (IA annualreportnat1992nati).pdf
Rabu, 2024-08-21 13:43:02cell division. We tested several 15-18 mer antisense ODNs targeted to PCNA mRNA, or to c-myc mRNA. Antisense ODNs to both PCNA and to c-myc inhibited expression...
Click to read more »File:RasiRNA 5' end.pdf
Selasa, 2021-03-30 21:54:035’ 3’ AGO3 3’ Antisense primary transcript 5’ AGO3 3’ 5’ 5’ AGO3 3’ 3’ 5’ 5’ 3’ 3’ PIWI/AUB 5’ 5’ 3’ PIWI/AUB 5’ 3’ 5’ Sense primary...
Click to read more »
File:Antisense DNA oligonucleotide.png
Minggu, 2026-03-08 18:16:18DescriptionAntisense DNA oligonucleotide.png English: Schematic showing how antisense DNA prevents protein translation. Date 20 January 2004 Source RNAi...
Click to read more »File:How did a duplicated gene copy evolve into a restorer-of-fertility gene in a plant? The case of Oma1.pdf
Sabtu, 2025-04-19 05:47:38190853 sense MMC T T (b) Tds antisense MMC MSp bvOma1 T T T Tds sense MMC MSp T T T (c) MSp antisense Tds MMC RF1-Oma1 T T T MSp...
Click to read more »File:Biotechnology notes (IA CAT11115533036).pdf
Jumat, 2024-08-16 02:21:31genetically engineered tomato as food. Called FLAVR SAVR™, the tomato has an antisense gene that delays softening for an extended period of time, thus increasing...
Click to read more »File:A unified model of the standard genetic code.pdf
Senin, 2025-04-21 05:39:33existence of the other. Sense/antisense coding thus projects back past the genetic coding nexus to chemistry. The sense/antisense ancestry of the aaRS appears...
Click to read more »File:Commission Regulation (EU) 2018-781 of 29 May 2018 amending Regulation (EC) No 847-2000 as regards the definition of the concept similar medicinal product (Text with EEA relevance) (EUR 2018-781).pdf
Senin, 2024-04-08 00:08:33derivatives is not major, shall be considered similar. Therefore for antisense or interfering nucleotide substances, addition, substitution or deletion...
Click to read more »
File:C4-antisense-RNA.svg
Jumat, 2024-01-12 13:22:08DescriptionC4-antisense-RNA.svg English: Adapted from figures I created for this paper: (http://genomebiology.com/2010/11/3/R31). The journal distributes...
Click to read more »File:WRAP53 and p53.pdf
Senin, 2021-11-15 21:03:4017p13.1 Chromosome 17 p53 - Strand + Strand WRAP53 (WD40-encoding RNA Antisense to p53) 1γ p53 4 3 2 Hp53int1 WRAP53γ 1α 1β 2 4 5 6 7 8 ...
Click to read more »
File:Antisense riboregulator.jpg
Kamis, 2023-09-07 18:14:31DescriptionAntisense riboregulator.jpg English: Drawing from US Patent 6,323,003 to Black Source US Patent No. 6,323,003 Author Black Permission (Reusing...
Click to read more »
File:Polaritaet antisense ar.png
Rabu, 2022-02-23 06:04:07DescriptionPolaritaet antisense ar.png العربية: توضيح لجينوم الرنا سالب الدلالة (السلسلة -). Date 1 February 2022 Source this file Author Gleiberg translated...
Click to read more »File:EUR 2000-847.pdf
Kamis, 2026-05-28 18:51:58derivatives is not major, shall be considered similar. Therefore for antisense or interfering nucleotide substances, addition, substitution or deletion...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubli1994nati).pdf
Minggu, 2024-08-25 18:36:17the frequencies used (9000 MHz). We are. currently developing pulsed antisense oligonu- become important is against their deleterious effects. mRNA...
Click to read more »
File:Eukaryotic RNA Polymerase II rotating.gif
Sabtu, 2025-07-19 13:52:39English A rotating yeast RNA Polymerase II in the midst of transcription. Antisense template DNA strand is green, sense DNA strand is yellow, nascent RNA...
Click to read more »
File:Antisense Oligonucleotide Use in ncRNA therapy.png
Kamis, 2023-09-07 18:14:31DescriptionAntisense Oligonucleotide Use in ncRNA therapy.png English: ASO (Antisense oligonucleotide) are indicated as blue single stranded molecules...
Click to read more »![File:Antisense DNA oligonucleotide.svg Minggu, 2026-03-29 04:43:20 [[File:Antisense DNA oligonucleotide.svg|lang=zxx]]... Click to read more »](https://profilpelajar.com/simple/File:Antisense_DNA_oligonucleotide.svg){kind=link}
File:Antisense DNA oligonucleotide.svg
Minggu, 2026-03-29 04:43:20[[File:Antisense DNA oligonucleotide.svg|lang=zxx]]...
Click to read more »
File:Polaritaet antisense nl.png
Selasa, 2022-03-29 22:26:31DescriptionPolaritaet antisense nl.png English: Now with Dutch txt Nederlands: Met Nederlandse tekst Date 15 December 2013 Source File:Polaritaet_antisense.png Author...
Click to read more »
File:Eukaryotic transcripton bubble with and without RNA Polymerase II.png
Minggu, 2026-03-08 20:49:23truetrue English A. Transcription bubble showing DNA strands in green (antisense, template strand) and yellow (sense strand), and growing RNA in red. B...
Click to read more »File:Activation of immediate early genes by drugs of abuse (IA activationofimme00grza).pdf
Selasa, 2025-05-27 16:52:26al. 1988; Muller et al. 1984; Ryder and Nathans 1988). Studies using antisense RNAs or oligonucleotides or antibodies have shown that the expression...
Click to read more »File:The chinchilla as a novel animal model of pregnancy.pdf
Minggu, 2025-04-20 03:46:57TGA CAG TGC GTA TG-3� , antisense 5� -TCA CAA CAT CGG AGA TTC CA-3� . β-Actin: sense 5� -GAG ATG AAG CCC AGA GCA AG-3� , antisense 5� -CTG GGT CAT CTT CTC...
Click to read more »File:Identification and characterization of circular RNAs in Qinchuan cattle testis.pdf
Sabtu, 2025-04-19 06:10:04circRNA, EIciRNA), intronic sequences (circularized intron RNA, ciRNA), antisense or the intergenic region. Although the function of animal circRNAs is...
Click to read more »
File:HOXA11-AS lncRNA Antisense Gene Expression.png
Senin, 2025-11-17 16:23:17DescriptionHOXA11-AS lncRNA Antisense Gene Expression.png English: Indicated lncRNA, a class of non-protein coding RNA longer than 200 nucleotides, regulating...
Click to read more »
File:C4-antisense-RNA-target-a1b1.svg
Jumat, 2024-01-12 13:22:06DescriptionC4-antisense-RNA-target-a1b1.svg English: Adapted from figures I created for this paper: (http://genomebiology.com/2010/11/3/R31). The journal...
Click to read more »_.png){kind=link}
File:Figure1 Definition of antisense RNAs (asRNAs) .png
Kamis, 2024-01-25 01:09:31DescriptionFigure1 Definition of antisense RNAs (asRNAs) .png English: AsRNA is transcribed from the lagging strand of a gene and is complementary to...
Click to read more »
File:Rna antisense.png
Kamis, 2023-01-26 03:28:24DescriptionRna antisense.png Italiano: La trascrizione da entrambi filamente di DNA genera due diverse molecole di RNA sulla sinistra mRNA e sulla destra...
Click to read more »File:Biotechnology notes (IA CAT11115533080).pdf
Selasa, 2024-11-12 19:57:36Please call 212-661-8740 for more information. Sept. 21-22: The Art of Antisense. New Orleans, LA. Conference sponsored by Nature Medicine. For more information...
Click to read more »File:Selected speeches and news releases - United States Department of Agriculture, Office of Public Affairs. (IA CAT10655231087).pdf
Senin, 2024-08-19 00:17:21gene, however, contains die message in reverse. Scientists suspect diis “antisense RNA’’ binds to die normal message produced by unmodified genes. That leaves...
Click to read more »File:Biotechnology notes (IA CAT11115533079).pdf
Minggu, 2024-08-18 19:27:03FL. To order, please call 407-994-0555. Carbohydrate Modifications in Antisense Research. Edited by Y. S. Sanghvi and P. Published by the American Chemical...
Click to read more »File:1992 PHS technology transfer directory - NIH-ADAMHA-CDC-FDA (IA 1992phstechnolog00nati).pdf
Minggu, 2024-08-18 15:53:12Antiviral Drugs Diagnostics Nonsteroidal AIDS Ocular CARDIOVASCULAR ANTISENSE Molecular Biology Angiogenesis Antiarrhythmics Anticoagulants Therapeutic...
Click to read more »File:Biotechnology notes (IA CAT11115533039).pdf
Minggu, 2024-08-18 04:46:06Environmental Biotechnology, Knoxville, TN. Call 615-675-9450. Jan. Jan 12-15: Antisense Strategies. the New York Academy of Sciences. Philadelphia, PA. Sponsored...
Click to read more »File:Cambrian origin of the CYP27C1-mediated vitamin A1-to-A2 switch, a key mechanism of vertebrate sensory plasticity.pdf
Sabtu, 2025-08-23 13:59:09sections of retina and RPE from juvenile and adult lamprey. The CYP27C1 antisense probe labels the CYP27C1 transcript in the RPE of adults; only weak background...
Click to read more »File:Biotechnology notes (IA CAT11115533057).pdf
Kamis, 2025-09-18 12:18:37531 ; Antibody Methods. Fax: -H 44-244-8 14305. of El Sept. 9-10: Antisense Symposium. Ames, Iowa. Sponsored by The Walter E. and Helen Parke Loomis...
Click to read more »File:EUD 2015-692.pdf
Kamis, 2026-05-28 14:58:00construct consisting of a partial dihydroflavonol 4-reductase dfr sense and antisense fragment separated by a petunia dfr intron, targeted to specific, post-transcriptional...
Click to read more »File:OJ L 132 of 2018 - FI Finnish.pdf
Sabtu, 2025-06-28 09:50:02nukleotidisekvenssin ero ei ole suuri, katsotaan vastaavanlaisiksi. Tämän vuoksi antisense-aineiden tai häiritsevien nukleotidien osalta sellaisen nukleotidin lisääminen...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreportnati19924nati).pdf
Senin, 2024-11-18 14:28:52to Defined Cell Lines 1002 CM-06526-02 Modulation of Cell Growth by Antisense & Antigene Reagents 1005 CM-06527-02 Oncologic Aspects of Tyrosine...
Click to read more »File:Functional differences of BaPDS1 and BaPDS2 genes in Chinese kale.pdf
Selasa, 2025-11-25 21:21:32the mutants of Phytophthora in 1992 by Perker et al. [6]. In 1995, the antisense expression of the PDS gene was performed in Nicotiana benthamiana and...
Click to read more »
File:Amflora mechanism.svg
Senin, 2023-08-28 10:39:36bytes) {{Information |Beschreibung = Beschreibung des Mechanismus von Antisense-RNA am Beispiel von Amflora |Quelle = Eigenes Werk. |Urheber =...
Click to read more »File:Biotechnology of algae - a bibliography (IA CAT93501038).pdf
Selasa, 2025-09-30 19:49:25reinhardtii; strains; transposable elements; transcription; patterns; antisense rna; inheritance; progeny; strain differences; molecular mapping; genetic...
Click to read more »File:Biotechnology notes (IA CAT11115533067).pdf
Rabu, 2024-08-21 17:08:0247-776-71832. Sept. 9-10: Symposium on Down Regulation of Gene Expression by Antisense and Other Technologies. Ames, Iowa. Call 515-294-1063; Fax: 515-294-1337...
Click to read more »File:OJ L 132 of 2018 - EN English.pdf
Rabu, 2026-01-07 13:46:25derivatives is not major, shall be considered similar. Therefore for antisense or interfering nucleotide substances, addition, substitution or deletion...
Click to read more »File:LL-Q1860 (eng)-Wodencafe-antisense.wav
Kamis, 2024-08-08 22:03:14(eng)-Wodencafe-antisense.wav Audio pronunciation file from the Lingua Libre project. Language InfoField English Transcription InfoField antisense Date 2 June...
Click to read more »File:Probe - newsletter for the USDA Plant Genome Research Program (IA CAT91962362006).pdf
Senin, 2024-08-26 03:59:58Patentability of 19, 20 Hyatt Regency San Diego Genes Gene Therapy and Antisense Newly Discovered Properties of Nucleic Acids Co-Sponsored By: The...
Click to read more »File:NMRDC Outlook Newsletter Vol 4 Issue 2 (IA NMRDCOutlookNewsletterVol4Issue2Aug1993).pdf
Sabtu, 2024-07-20 13:24:26research projects in the area of both dengue fever virus and malaria, using antisense materials. New materials and information developed by the Government is...
Click to read more »File:Annual report of intramural activities (IA annualreportofin19951nati).pdf
Minggu, 2024-08-18 12:54:34block death by: 1) expressing in the cells adequate levels of specific antisense RNAs or dominant negative mutants for "apoptotic" genes; 7-2 proteins...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl2003nati 0).pdf
Sabtu, 2025-10-04 15:21:09effect seen in animals. It was shown that the introduction into embryos of antisense (but. unexpectedly, also sense) dsRNA induced a sequence- gene silencing...
Click to read more »File:OJ L 180 of 2021 - CS Czech.pdf
Senin, 2025-06-30 22:39:38. . . . . . . . . . . . . . . .72 V.1.5.6 Přípravky pro léčbu pomocí antisense RNA a interference RNA . . . . . . . . . . . . . . . . . . . . . . . ...
Click to read more »File:OJ L 132 of 2018 - DE German.pdf
Sabtu, 2025-06-28 09:59:25ihrer Derivate besteht, werden als ähnlich angesehen. Daher wird bei „Antisense“-Wirkstoffen oder interferierenden Nukleotiden die Hinzufügung, Ersetzung...
Click to read more »File:Annual report - Center for Biologics Evaluation and Research Division of Virology (IA annualreportcent1992ce).pdf
Rabu, 2024-08-21 16:40:21COMMITTEES Editorial Board, Analytical Biochemistry Editorial Board, Antisense Research and Development Center for Biologies Committee to Revise the...
Click to read more »File:Annual report - National Institute on Alcohol Abuse and Alcoholism (IA annualreportnati1993na).pdf
Senin, 2024-08-19 01:25:11AA 00073-02 LNG Neurochemical sequelae of central administration of antisense oligonucleotides 259 M. Durcan Neurogenetics of alcohol-related behaviors...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport198842nati).pdf
Jumat, 2024-10-25 16:50:36have been made. active against HIV-1 by a mechanism independent of the antisense effect, but dependent upon the high affinity these drugs have for reverse...
Click to read more »File:Biotechnology notes (IA CAT11115533045).pdf
Minggu, 2024-08-18 22:59:39AROUND THE COUNTRY (AND THE WORLD) CONTENTS: GENETICALLY MODIFIED WITH ANTISENSE PG, VR/TYLCV, PE, pTOM1 3, THERMAL HYSTERESIS, CYTOKININ, TRANSPOSABLE...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport199041nati).pdf
Jumat, 2024-10-25 16:50:40subset of Burkitt's lymphomas. This has been accomplished by using an antisense oligonucleotide directed against intron sequences that are present in...
Click to read more »File:OJ L 132 of 2018 - CS Czech.pdf
Sabtu, 2025-06-28 09:58:51nebo jejich derivátů není závažnější, se považují za podobné. Proto se „antisense“ nebo interferující nukleotidy lišící se přidáním, nahrazením nebo vypuštěním...
Click to read more »File:OJ L 180 of 2021 - SK Slovak.pdf
Senin, 2025-06-30 22:42:12. . . . . . . . . . . . . . . . . . . . . . . . . . .72 V.1.5.6. RNA antisense terapeutické produkty a RNA interferenčné terapeutické produkty . . ....
Click to read more »File:OJ L 132 of 2018 - NL Dutch.pdf
Sabtu, 2025-06-28 09:52:32of hun derivaten gering is, worden als gelijkwaardig beschouwd. Voor antisense-nucleotiden of interfererende nucleotiden wordt toevoeging, substitutie...
Click to read more »File:The Peach RGF-GLV Signaling Peptide pCTG134 Is Involved in a Regulatory Circuit That Sustains Auxin and Ethylene Actions.pdf
Kamis, 2025-01-02 16:12:26transformed vector was further used as template for the creation of sense and antisense probes by an in vitro transcription performed with SP6 and T7 polymerases...
Click to read more »File:OJ L 180 of 2021 - FI Finnish.pdf
Senin, 2025-06-30 22:40:13. . . . . . . . . . . . . . . . . . . . . . . . . . .72 V.1.5.6. RNA-antisense-terapiaan ja RNA-interferenssiterapiaan tarkoitetut valmisteet . . . ...
Click to read more »
File:Antisense small RNA identification using RNA Array.jpeg
Jumat, 2025-07-11 16:05:46Henderson, C. A., Vincent, H. A., & Callaghan, A. J. (2021). Reprogramming Gene Expression by Targeting RNA-Based Interactions: A Novel Pipeline Utilizing...
Click to read more »File:OJ L 180 of 2021 - EN English.pdf
Senin, 2025-06-30 22:39:58. . . . . . . . . . . . . . . . . . . . . . . . . . .72 V.1.5.6. RNA antisense therapy and RNA interference therapy products . . . . . . . . . . . ....
Click to read more »File:Antisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s4.ogv
Rabu, 2024-06-05 18:46:58DescriptionAntisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s4.ogv English: Supplementary...
Click to read more »File:Identification of copper (Cu) stress-responsive grapevine microRNAs and their target genes by high-throughput sequencing.pdf
Sabtu, 2025-04-19 06:10:103442 19 338 890 981 639 803 1 440 698 category Exon_antisense Exon_sense Intron_antisense Intron_sense Known_miRNA miRNA rRNA rRNAetc repeat snRNA...
Click to read more »File:Antisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s2.ogv
Rabu, 2024-06-05 18:46:54DescriptionAntisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s2.ogv English: Supplementary...
Click to read more »File:Chromatin-remodelling-and-antisense-mediated-up-regulation-of-the-developmental-switch-gene-eud-1-ncomms12337-s2.ogv
Rabu, 2026-02-11 03:54:13DescriptionChromatin-remodelling-and-antisense-mediated-up-regulation-of-the-developmental-switch-gene-eud-1-ncomms12337-s2.ogv English: Supplementary...
Click to read more »File:OJ L 180 of 2021 - HR Croatian.pdf
Selasa, 2025-12-02 05:32:07. . . . . . . . . . . . . . . . . .72 V.1.5.6. Proizvodi namijenjeni antisense RNK terapiji i terapiji RNK interferencijom . . . . . . . . . . . . ....
Click to read more »File:Lessons from Citizendium.pdf
Sabtu, 2020-10-31 19:48:10Most seriously, it retains the incorrect definition of the sense and antisense strands that we fixed in February. If anybody with access to this page...
Click to read more »File:Proceedings, 22nd Southern Forest Tree Improvement Conference, June 14-17, 1993, Atlanta, Georgia (IA proceedings22nds44sout).pdf
Rabu, 2026-01-07 18:05:58will look and taste like other backyard tomatoes. The difference is an antisense genetic construct that reduces rotting, thus allowing it to be picked...
Click to read more »File:Adaptation of the carbamoyl-phosphate synthetase enzyme in an extremophile fish.pdf
Senin, 2025-04-21 05:39:54absence of CPS III RNA. 2.3. In situ hybridization For the production of antisense probes, complementary to the mRNA of CPS III to use in in situ hybridization...
Click to read more »File:Antisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s3.ogv
Rabu, 2024-06-05 18:46:55DescriptionAntisense-oligonucleotide-mediated-Dnm2-knockdown-prevents-and-reverts-myotubular-myopathy-in-mice-ncomms15661-s3.ogv English: Supplementary...
Click to read more »File:Transgenic fish research - update, January 1993-March 1995 (IA CAT30936041).pdf
Minggu, 2024-08-18 21:26:48disease-resistance, sexual-reproduction; environmental-impact using antisense RNA constructs or the production of vaccines for fish viral disease such...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport198941nati).pdf
Jumat, 2024-10-25 16:50:38abnormalities may provide targets for specific therapeutic endeavors. Antisense oligonucleotide 10 directed against intron sequences present in the...
Click to read more »File:Opsin genes of select treeshrews resolve ancestral character states within Scandentia.pdf
Sabtu, 2025-08-23 12:50:27). Purified PCR products were directly Sanger sequenced on sense and antisense strands at the University of Calgary Core DNA Sequencing Facility (Faculty...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl2005nati 2).pdf
Minggu, 2024-08-18 06:44:37reducing side effects, Mannon says. These include IL-10; ISIS-2302 (an antisense oligonucleotide to ICAM-1); an anti-IL-6 receptor monoclonal antibody;...
Click to read more »File:Annual report - National Institute of Child Health and Human Development, Division of Intramural Research (IA annualreportnati1997natio).pdf
Minggu, 2024-08-18 00:51:50collagen pathophysiology, and are the basis of attempts to develop selective antisense hammerhead ribozyme suppression of the mutant collagen allele, as a promising...
Click to read more »File:Problems of drug dependence, 2001 - proceedings of the 63rd Annual Scientific Meeting, the College on Problems of Drug Dependence, Inc. (IA problemsofdrugde00coll 3).pdf
Kamis, 2025-01-02 03:02:07principle, could be depleted. This is a technique in pharmacology of antisense oligonucleotides and conditional gene knockouts for receptor depletion...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualre198622nati).pdf
Senin, 2024-11-18 14:28:50cells. In addition, newer technologies involving transgenic mice and antisense messenger RNA are likely to yield even more powerful experimental approaches...
Click to read more »File:OJ C 202403209 of 2024 - EN English.pdf
Minggu, 2025-10-05 23:00:49sequen cing/synthesis/amplification; gene expression profiling, and use of antisense technol ogy; large-scale DNA synthesis; new genomic techniques; gene...
Click to read more »File:Integrating human endogenous retroviruses into transcriptome-wide association studies highlights novel risk factors for major psychiatric conditions.pdf
Sabtu, 2026-05-09 00:11:35promote the formation of double stranded RNA (dsRNA), which can activate antisense RNA (asRNA) pathways to target gene expression regulation. It can also...
Click to read more »File:A biologically based approach to the mutation of code (IA biologicallybase00vand).pdf
Minggu, 2024-08-18 21:43:46Replication Meiosis 83 87 89 90 Promoter Consensus Sequences Sense and Antisense Strands The Amino Acids 91 Relative Fitness of a One Locus, Two Allele...
Click to read more »File:NMRDC Outlook Newsletter Vol 4 Issue 3 (IA NMRDCOutlookNewsletterVol4Issue3).pdf
Sabtu, 2025-05-10 11:10:16is to develop a novel therapy for sepsis and septic shock by combining antisense oligonucleotide technology with targeted delivery systems. This approach...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl2000nati 2).pdf
Sabtu, 2025-10-04 15:20:39normal IL-12, IFN-y, and oxide levels associated that the viral in antisense orientation, the cells signal The Notch family of genes encodes transmembrane...
Click to read more »File:OJ C 202403209 of 2024 - FI Finnish.pdf
Minggu, 2025-10-05 23:01:04sekvensointi/synteesi/amplifikaatio; geeniekspression profilointi ja antisense-tekniikan käyttö; pitkien DNA-jaksojen synteesi; uudet genomitekniikat;...
Click to read more »File:LL-Q1860 (eng)-Wodencafe-antisenses.wav
Kamis, 2025-08-14 03:22:33(eng)-Wodencafe-antisenses.wav Audio pronunciation file from the Lingua Libre project. Language InfoField English Transcription InfoField antisenses Date 2 June...
Click to read more »File:Wsv023 interacted with Litopenaeus vannamei γ-tubulin complex associated proteins 2, and decreased the formation of microtubules.pdf
Minggu, 2025-04-20 05:12:39polymerase promoter sequence was added to 5� -end of the forward primer. For antisense ssRNA synthesis, the DNA template contained a T7 RNA polymerase promoter...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport19942nati).pdf
Jumat, 2024-11-15 13:32:58Biochemistry Section CB-05216-23 CB-08281-12 Site-Selective cAMP Analogs and Antisense Oligonucleotides as Antineoplastics and Chemopreventives 522 Mechanism...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl1997nati 0).pdf
Sabtu, 2025-05-10 02:18:54ignored, only that Cell Line Cancer Chemotherapeutic Drug, 2-F-Ara-A Antisense Phosphorothioate Nucleotides Freire points to the “neurotransmitter ...
Click to read more »_and_high_power_(panel_B)..jpg){kind=link}
File:Lgr5 in situ hybridization autoradiographs using 35S-labeled antisense probes are shown at low power (panel A) and high power (panel B)..jpg
Sabtu, 2026-05-30 04:33:36DescriptionLgr5 in situ hybridization autoradiographs using 35S-labeled antisense probes are shown at low power (panel A) and high power (panel B)..jpg...
Click to read more »File:FEDLINK - United States Federal Collection (IA CAT10685528).pdf
Selasa, 2024-10-08 01:22:58assessment and agronomic research. 4. Explore the feasibility of using antisense and ribozyme technology for decreasing levels of natural toxicants in...
Click to read more »File:Annual report - National Institutes of Health. Division of Computer Research and Technology (IA annualreportnati1991nati).pdf
Minggu, 2024-08-18 20:26:47Graessman gene expression using ipicroinjected .\. Inhibition of .small antisense SV40 molecules, Nucleic .\cid Research 1991;19:53-59. DCRT Convex...
Click to read more »File:Annual report - National Heart, Lung, and Blood Institute (IA annualreportn1993nati).pdf
Minggu, 2024-08-18 12:24:31constructed retroviral vectors that express SCD4, transdominant REV mutants, antisense RNA for TAR, and HIV inducible vectors for a-interferon, cytosine deaminase...
Click to read more »File:Evaluation of the silkworm lemon mutant as an invertebrate animal model for human sepiapterin reductase deficiency.pdf
Minggu, 2025-04-20 05:42:188-BH2 SPR/CR AR/CR Table 1. The primers used for PCR and RT-qPCR. antisense primer BmActin3 50 AACACCCCGTCCTGCTCACTG30 50 GGGCGAGACGTGTGATTTCCT30...
Click to read more »File:Annual report - National Institute of Child Health and Human Development (IA annualreportnati19954nati).pdf
Minggu, 2024-08-25 04:09:50influencing polyA length to affect the competition between sense and antisense that determines priming it is its ability. It RNA seems plausible...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport199141nati).pdf
Jumat, 2024-10-25 16:50:40explanation for the association of EBV with Burkitt's lymphoma. 2. 3. Antisense oligonucleotides have been used to inhibit expression of the c-myc gene...
Click to read more »File:Genome mapping research-plants - a directory of USDA and state projects in CRIS (IA CAT11107144).pdf
Sabtu, 2024-08-17 23:41:46sequence analyses being done to identify promoter elements. RothUohnson; antisense RNA inhibition of plant virus. Sequences complementary to the 5' region...
Click to read more »File:S41467-018-04698-4.pdf
Senin, 2026-06-01 02:49:47transcription first mechanisms. However, most of these non-coding transcripts are antisense of bona fide coding regions and would not generate the shift in G + C composition...
Click to read more »
File:Aufbau eines Lipoproteins.jpg
Rabu, 2024-01-10 02:42:11https://commons.wikimedia.org/wiki/user:AntiSense Wikimedia username: AntiSense author name string: AntiSense determination method or standard: SHA-1...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl2000nati 1).pdf
Minggu, 2024-08-25 17:21:44non-p53-dependent pathway. Research is currently directed toward the use of an mtCLIC antisense construct to block expression in keratinocytes and in and other mem-...
Click to read more »File:Annual report - National Institute of Diabetes and Digestive and Kidney Diseases (IA annualreportnati1994n).pdf
Minggu, 2024-08-18 13:12:06These include 3T3-L1 adipoblasts stably transfected with both sense and antisense perilipin cDNA constructs as well as adrenal cortical cells transfected...
Click to read more »File:Federal Register 2009-07-17- Vol 74 Iss 136 (IA sim federal-register-find 2009-07-17 74 136).pdf
Minggu, 2024-08-18 18:40:0734761 Prospective Grants of Exclusive Licenses; Use of CD47 Antibodies, Antisense Oligonucleotides, and Small Molecules to Treat Disease, etc., 34766-34767...
Click to read more »File:MUSCULAR DYSTROPHY (IA gov.gpo.fdsys.CHRG-107shrg72125).pdf
Minggu, 2024-08-25 03:45:57repair machinery to correct some types of defect in the dystrophin gene. ‘‘Antisense’’ nucleotides are another type of synthetic molecule that has therapeutic...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreport19932nati).pdf
Jumat, 2024-10-25 16:50:43Biochemistry Section CB-05216 CB-08281 Site-Selective cAMP Anadogs and Antisense Oligonucleotides as Antineoplastics and Chemopreventives 669 Mechanism...
Click to read more »File:Annual report - National Cancer Institute (U.S.) (IA annualreportnati19912nati).pdf
Jumat, 2024-10-25 16:50:50colleagues are studying the role of prothymosin a in cell division using antisense oligomers directed against several regions of prothymosin a mFlNA. They...
Click to read more »File:Ambient Temperature-Responsive Mechanisms Coordinate Regulation of Flowering Time.pdf
Minggu, 2023-08-06 07:17:16of FLC [75,77,83]. COOLAIR is transcribed from the 30 end of FLC in an antisense direction and COOLAIR transcripts can be classified into two groups based...
Click to read more »File:Fact book (IA factbook00nati 4).pdf
Minggu, 2024-08-18 14:34:20disease, lymphangioleiomyomatosis, pulmonary artery catheterization, and antisense technology. Asthma research is an area of high priority for the Division...
Click to read more »File:Novel RNA variants in colorectal cancers.pdf
Minggu, 2025-06-01 03:27:47database of the chimeric transcripts and RNA-seq data with novel sense-antisense chimeric RNA transcripts. Nucleic Acids Res. 2014; 43:D68–75. 8. Løvf...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl2005nati 1).pdf
Kamis, 2020-07-23 15:03:22we CMV . Deciding to place as much — the first of its class an antisense dmgfor CMV. And we were also involved in the it in ex- broader as...
Click to read more »File:Annual report - National Heart, Lung, and Blood Institute (IA annualreportnati19871nati).pdf
Sabtu, 2024-08-24 19:45:28(human) parvovirus Pharmacological manipulation of HbF synthesis Use of antisense RNA or DNA to inhibit gene expression Identification of Cis and transacting...
Click to read more »File:AFIP Letter Vol. 153, No. 6, December 1995 (IA AFIPLetter199512).pdf
Minggu, 2024-08-18 14:00:05carcinomas from Hong Kong Chinese patients. By in situ hybridi zation using antisense Epstein-Barr virus early RNA (EBER) probe, seven tumors were shown to...
Click to read more »File:Annual report - National Institute on Alcohol Abuse and Alcoholism (IA annualreportnati1994nat).pdf
Rabu, 2024-08-21 17:16:45the GABA^ receptor a6 subunit in alcohol-induced motor impairment 293 Antisense oligonucleotides to block gene expression 295 Section on Human Neurogenetics...
Click to read more »File:Global climate change research report (IA CAT10690112).pdf
Minggu, 2024-08-18 01:55:41Similar results were obtained with transgenic Nicotiana plants contain¬ ing antisense DNA sequences designed to de¬ crease the rubisco protein concentration...
Click to read more »File:Annual report - National Institute of Arthritis and Musculoskeletal and Skin Diseases (IA annualreportnatio1989nati).pdf
Sabtu, 2024-08-24 19:52:30bind to non-retroviral bands on Northern analysis. We conclude that the antisense interfered with a normal inhibitory process in which retroviral sequences...
Click to read more »File:OJ C 202403209 of 2024 - NL Dutch.pdf
Minggu, 2025-10-05 23:01:51cing/synthese/amplificatie; genexpressieprofilering en het gebruik van antisense-tech nologie; grootschalige DNA-synthese; nieuwe genomische technieken...
Click to read more »File:The NIH catalyst - a publication for NIH intramural scientists (IA nihcatalystpubl1996nati 2).pdf
Sabtu, 2025-10-04 15:21:10Meeting time: Wednesdays, 4:15 p.m. (see NIH Calendar of Events) IMMUNI-L Antisense Interest Group Umbrella Group: Clinical Research Meeting time: Last Thursday...
Click to read more »File:ALU non-B-DNA conformations, flipons, binary codes and evolution.pdf
Senin, 2025-04-21 08:09:37regulation is quite complex. With the sphingosine kinase 1 (SPHK1) gene, an antisense RNA KHPS1 forms a triplex at the SPHK1 enhancer, then recruits transcription...
Click to read more »File:Methylation of avpr1a in the cortex of wild prairie voles - effects of CpG position and polymorphism.pdf
Minggu, 2025-09-07 18:08:46autoradiogram shows V1aR abundance at the retrosplenial cortex (RSC). Right, antisense RNA in situ staining shows expression of GATA2 in the retrosplenial area...
Click to read more »File:Journal.pbio.3000337.pdf
Sabtu, 2020-09-05 13:19:56type I toxin-antitoxin system the synthesis of which is repressed by an antisense RNA during bacterial growth. Herein, we designed novel pseudopeptides...
Click to read more »File:Annual report - National Heart, Lung and Blood Institute. National heart, blood vessel, lung, and blood program (IA annualreport1985nati).pdf
Kamis, 2025-07-10 12:31:28manipulation of HbF synthesis Inhibition of oncogene expression with antisense RNA-___________ Molecular defects in beta thalassemia----__-____---_ Characterization...
Click to read more »File:S41467-019-10366-y.pdf
Jumat, 2024-07-19 17:02:00by RNAscope using 5 μm thick spleen sections from infected animals and antisense probe V-HIV-1 Clade-B designed for targeting base pairs 854–8291 of HIV-1NL4–3...
Click to read more »File:Transcriptome analysis identified long non-coding RNAs involved in the adaption of yak to high-altitude environments.pdf
Sabtu, 2025-10-11 21:14:57Regulation of chromatin structure by long noncoding RNAs: focus on natural antisense transcripts. Trends Genet. 28, 389–396. (doi:10.1016/j.tig.2012.03.013)...
Click to read more »
File:Structure of a Lipoprotein.jpg
Senin, 2022-08-29 13:46:21may select the license of your choice. English object of statement has role: photographer author name string: AntiSense Wikimedia username: AntiSense...
Click to read more »
File:Structure of a Lipoprotein.png
Sabtu, 2026-03-14 15:51:45You may select the license of your choice. English author name string: AntiSense Wikimedia username: AntiSense determination method or standard: SHA-1...
Click to read more »
File:Aufbau eines Lipoproteins.png
Senin, 2023-10-02 05:03:29You may select the license of your choice. English author name string: AntiSense Wikimedia username: AntiSense determination method or standard: SHA-1...
Click to read more »
File:Structure of LDL receptor family members.png
Jumat, 2021-06-25 23:29:14org/licenses/by-sa/3.0CC BY-SA 3.0 Creative Commons Attribution-Share Alike 3.0 truetrue English author name string: AntiSense Wikimedia username: AntiSense...
Click to read more »
File:Phosphorothioate RNA.svg
Kamis, 2026-04-02 05:01:02English: Chemical structure of phosphorothioate RNA, a structure used in antisense oligonucleotides Date 22 March 2013 Source Own work Author Anypodetos...
Click to read more »
File:Phosphorothioate DNA.svg
Jumat, 2026-03-13 18:31:22English: Chemical structure of phosphorothioate RNA, a structure used in antisense oligonucleotides Date 22 March 2013 Source Own work Author Anypodetos...
Click to read more »
File:Custirsen.svg
Sabtu, 2025-12-27 18:37:31DescriptionCustirsen.svg English: Colored skeletal formula of custirsen—an antisense oligonucleotide. Date 1 July 2024 Source Own work Author Vaccinationist...
Click to read more »
File:Oblimersen.svg
Minggu, 2024-06-23 18:26:10DescriptionOblimersen.svg English: Colored skeletal formula of oblimersen—an antisense oligonucleotide investigated as a treatment for cancer. Date 22 June 2024...
Click to read more »
File:Olezarsen sodium.svg
Kamis, 2025-08-21 22:28:39skeletal formula of olezarsen (as sodium salt; brand name Tryngolza)—an antisense oligonucleotide used in the treatment of familial chylomicronemia syndrome...
Click to read more »
File:Inotersen.svg
Jumat, 2025-07-04 21:07:14skeletal formula of inotersen (as sodium salt; brand name Tegsedi)—an antisense oligonucleotide used in the treatment of polyneuropathy of hereditary...
Click to read more »
File:Eplontersen.svg
Sabtu, 2026-01-03 09:10:05skeletal formula of eplontersen (as sodium salt; brand name Wainua)—an antisense oligonucleotide used in the treatment of polyneuropathy of hereditary...
Click to read more »
File:Donidalorsen.svg
Sabtu, 2026-03-21 01:15:19skeletal formula of donidalorsen (as sodium salt; brand name Dawnzera)—an antisense oligonucleotide used in the treatment of hereditary angioedema. Date 22...
Click to read more »
File:C9orf43 interaction.png
Jumat, 2024-01-12 14:28:06DescriptionC9orf43 interaction.png English: antisense spliced gene POLE Date 6 May 2018 Source Own work Author Slazzaroni...
Click to read more »
File:Afovirsen.svg
Minggu, 2023-07-23 21:12:57DescriptionAfovirsen.svg English: Afovirsen is an oligonucleotide capable of antisense interactions with mRNA of human papillomavirus. It is a sequence of 20...
Click to read more »
File:ARN antisens 1.jpg
Selasa, 2023-06-20 23:51:16DescriptionARN antisens 1.jpg English: Antisense RNA Date 4 October 2014, 13:23:05 Source File:Antisense_DNA_oligonucleotide.png Author Jsanchezd...
Click to read more »
File:Nicotiana tabacum fpls-12-642879-g004.jpg
Selasa, 2025-07-15 23:49:29fpls-12-642879-g004.jpg Figure 4. In situ hybridization with SCI1, NAG1, and NtWUS antisense probes. (A–C) In situ hybridization in very young floral buds with the...
Click to read more »
File:MiRNA processing.svg
Kamis, 2025-06-19 05:03:37microRNA transcript pre-miRNA = precursor microRNA miRNA = microRNA miRNA* = antisense microRNA miRISC = microRNA-induced silencing complex Date 7 April 2008...
Click to read more »
File:RF02746.svg
Sabtu, 2020-09-19 14:35:24DescriptionRF02746.svg English: Consensus secondary structure of antisense RNA of rseC mRNA Date 18 July 2018 Source Source Rfam database and http://rfam...
Click to read more »
File:Nicotiana tabacum fpls-12-642879-g002.jpg
Selasa, 2025-07-15 23:49:21(C) In situ hybridization of a flower bud (advanced stage –8) with SCI1 antisense probe. Scale bar: 100 μm. (D) SEM of a flower bud at stage –7 (as defined...
Click to read more »
File:ERICH4 Genomic Neighborhood.png
Selasa, 2025-09-02 20:58:39is located within DMAC2 and next PCAT19 and B3NT8 which are all on the antisense strand. Date 4 May 2019 Source Own work Author Northern hummingbird...
Click to read more »
File:Volanesorsen.svg
Jumat, 2025-09-19 21:15:15svg English: Complete sequence of volanesorsen (brand name Waylivra)—an antisense oligonucleotide used in the treatment of familial chylomicronemia syndrome...
Click to read more »
File:Nusinersen sodium.svg
Senin, 2026-06-08 02:32:59Skeletal formula of nusinersen (as sodium salt; brand name Spinraza) — an antisense oligonucleotide approved for the treatment of spinal muscular atrophy...
Click to read more »
File:Mipomersen.svg
Minggu, 2025-12-21 07:43:23English: Complete sequence of of mipomersen (brand name Kynamro) — an antisense oligonucleotide approved for the treatment of homozygous familial hypercholesterolemia...
Click to read more »
File:Tofersen.svg
Senin, 2025-03-17 00:56:18English: Colored skeletal formula of tofersen (brand name Qalsody)—an antisense oligonucleotide used for the treatment of amyotrophic lateral sclerosis...
Click to read more »
File:Nusinersen sodium colored.svg
Senin, 2025-11-24 11:20:14skeletal formula of nusinersen (as sodium salt; brand name Spinraza) — an antisense oligonucleotide approved for the treatment of spinal muscular atrophy...
Click to read more »
File:Mipomersen sodium colored.svg
Minggu, 2026-05-24 07:32:24skeletal formula of mipomersen (as sodium salt; brand name Kynamro) — an antisense oligonucleotide approved for the treatment of homozygous familial hypercholesterolemia...
Click to read more ».gif){kind=link}
File:Chromosome 1 (66924895 to 67267726).gif
Selasa, 2025-09-16 00:43:31spanning from 66,924,895 to 67,267,726. The gene C1orf141 is encoded on the antisense strand. It overlaps slightly with the gene IL23R being encoded on the...
Click to read more »
File:Mipomersen sodium.svg
Minggu, 2026-05-24 07:32:07Skeletal formula of mipomersen (as sodium salt; brand name Kynamro) — an antisense oligonucleotide approved for the treatment of homozygous familial hypercholesterolemia...
Click to read more »
File:Antisenseoligonucleotide.jpg
Kamis, 2023-09-07 18:14:32DescriptionAntisenseoligonucleotide.jpg English: This figure shows how antisense oligonucleotides inhibit telomerase activity Date 4 November 2014, 10:23:24...
Click to read more »
File:FAM46B Promoter Region Txn Factor Binding Sites.png
Selasa, 2020-10-13 04:25:58factor binding sites with high matrix match scores and located on the antisense strand. Data obtained from El Dorado Date 12 May 2013, 03:15:03 Source...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s016.ogv
Sabtu, 2024-05-04 15:15:25Kupffer’s vesicle as observed with injected beads in zebrafish embryos after antisense MO injection. Microinjection of fluorescent beads into control MO injected...
Click to read more »
File:Acció dels oligonucleòtids antisentit en el tractament de l'amiloïdosi.png
Selasa, 2025-12-02 20:35:43I, the copyright holder of this work, hereby publish it under the following license: English Catalan Els oligonucleòtids antisentit (en lila) degraden...
Click to read more »
File:Eplontersen sodium.svg
Kamis, 2025-03-13 23:22:54I, the copyright holder of this work, hereby publish it under the following license: English Chemical structure of eplontersen sodium author name string:...
Click to read more »
File:TCF21 Activation.png
Selasa, 2023-01-31 07:06:56contains a promoter that directs transcription of TARID (a lncRNA) in antisense orientation to TCF21. TARID then induces TET protein-dependent DNA demethylation...
Click to read more »File:The-Entamoeba-histolytica-Arp23-Complex-Is-Recruited-to-Phagocytic-Cups-through-an-Atypical-Kinase-ppat.1005310.s009.ogv
Minggu, 2025-10-12 19:17:45trophozoites expressing antisense EhARPC1 RNA. The movie represents the effect on motility of amoeba, expressing EhARPC1 antisense RNA. Bar represents 10...
Click to read more »
File:DNA transcription.jpg
Sabtu, 2024-05-04 15:25:27jpg English: simple DNA transcription diagram featuring the sense and antisense strands of DNA and the production of messenger RNA via RNA polymerase...
Click to read more »
File:Acció dels oligonucleòtids antisentit en l'amiloïdosi.png
Selasa, 2025-12-02 20:33:39I, the copyright holder of this work, hereby publish it under the following license: English Catalan Acció dels oligonucleòtids antisentit en l'amiloïdosi...
Click to read more »
File:The transcriptome of pluripotent cells..jpg
Sabtu, 2024-11-16 01:20:10intergenic transcripts and antisense transcripts. The function of these novel transcripts in ES cells is not yet understood. Antisense transcripts are thought...
Click to read more »
File:C1orf112 Location.png
Kamis, 2025-08-07 12:15:501 open reading frame 112, indicating genes within the same region or antisense to C1orf112. Image courtesy of NCBI (National Center for Biotechnology...
Click to read more »
File:Miravirsen.svg
Kamis, 2025-11-20 15:47:26English determination method or standard: SHA-1...
Click to read more »
File:Nusinersen mechanism of action.svg
Sabtu, 2025-03-15 18:42:45amounts (approx. 10%) of functional SMN protein are produced by SMN2. The antisense oligonucleotide (ASO) nusinersen blocks the excision of exon 7 during...
Click to read more »
File:Qalsody Logo.png
Kamis, 2024-05-16 19:39:55English Logo used for marketing of Qalsody / Toferson...
Click to read more »
File:Volanesorsen sodium colored.svg
Rabu, 2025-10-22 03:44:07Skeletal formula of volanesorsen (as sodium salt; brand name Waylivra)—an antisense oligonucleotide used in the treatment of familial chylomicronaemia syndrome...
Click to read more »
File:Miravirsen.png
Rabu, 2020-10-07 21:39:38I, the copyright holder of this work, hereby publish it under the following license: English...
Click to read more »
File:Miravirsen structure.svg
Senin, 2024-07-15 04:23:35English Skeletal formula of miravirsen. author name string: Vaccinationist Wikimedia username: Vaccinationist URL: https://commons.wikimedia.org/wiki/User:Vaccinationist...
Click to read more »
File:Antiszensz gátlás mech.jpg
Kamis, 2023-09-07 18:19:27I, the copyright holder of this work, hereby publish it under the following license: This file is licensed under the Creative Commons Attribution-Share...
Click to read more »
File:RNA-in-situ-dark-field.jpg
Senin, 2025-07-21 02:12:19from an adult ewe hybridized to TGF-β1 antisense RNA. Silver grains indicating hybridization of the TGF-β1 antisense RNA are observed concentrated in thecal (t)...
Click to read more »
File:Journal pone 0008430 g001.png
Rabu, 2020-10-14 11:37:30pone 0008430 g001.png English: Schematic description of PEAR. Sense and antisense strands are represented by solid and dashed lines respectively, the 3′...
Click to read more »
File:RNA antisenso.png
Senin, 2025-09-08 17:32:15I, the copyright holder of this work, hereby publish it under the following license: This file is licensed under the Creative Commons Attribution-Share...
Click to read more »
File:Volanesorsen sodium.svg
Rabu, 2026-06-03 05:49:01Skeletal formula of volanesorsen (as sodium salt; brand name Waylivra)—an antisense oligonucleotide used in the treatment of familial chylomicronaemia syndrome...
Click to read more »
File:Inotersen-eplontersen-schematic.svg
Jumat, 2025-03-14 21:49:46I, the copyright holder of this work, hereby publish it under the following license: This file is licensed under the Creative Commons Attribution-Share...
Click to read more »
File:RF02812.svg
Kamis, 2025-10-23 13:33:16DescriptionRF02812.svg English: Consensus secondary structure of asponA antisense RNA Date 23 July 2018 Source Source Rfam database and http://rfam.xfam...
Click to read more »
File:Fpls-02-00042-g001.png
Selasa, 2025-07-15 15:41:22tomato plants. (A) Scheme of the XylT_RNAi construct (XylT in sense and antisense orientation). p35: 35S cauliflower mosaic virus promoter; T35S: terminator;...
Click to read more »
File:Custirsen 2D molestructure.png
Selasa, 2024-07-02 01:47:30I, the copyright holder of this work, hereby publish it under the following license: This file is licensed under the Creative Commons Attribution-Share...
Click to read more »
File:Morpholino.gif
Minggu, 2025-11-09 07:05:39Summerton in 1985 and were developed at ANTIVIRALS Inc., the pioneer antisense company founded by Summerton in 1980. Morpholino oligos are so named because...
Click to read more »
File:C1orf52 Gene Neighborhood.jpg
Selasa, 2025-10-21 17:50:23C1orf52 gene neighborhood. B-cell lymphoma 10 (BCL10), B-cell lymphoma antisense 1 (BCL-AS1), dimethylarginine dimethylaminohydrolase 1 (DDAH1), and synapse...
Click to read more »
File:Nicotiana tabacum fpls-12-642879-g001.jpg
Senin, 2025-07-21 02:47:12development. (A) In situ hybridization of inflorescence apex with SCI1 antisense probe. Four floral buds are observed. Scale bar: 500 μm. (B) Scanning...
Click to read more »
File:Timeline of ncRNA therapeutics.jpg
Selasa, 2026-03-24 06:15:30I, the copyright holder of this work, hereby publish it under the following license: This file is licensed under the Creative Commons Attribution-Share...
Click to read more »
File:Morpholino structure.gif
Sabtu, 2024-08-24 22:22:31Summerton in 1985 and were developed at ANTIVIRALS Inc., the pioneer antisense company founded by Summerton in 1980. Morpholino oligos are so named because...
Click to read more »
File:MiRNA processing.JPG
Sabtu, 2022-08-20 00:24:34microRNA transcript pre-miRNA = precursor microRNA miRNA = microRNA miRNA* = antisense microRNA miRISC = microRNA-induced silencing complex Date 9 January 2008...
Click to read more »
File:Genes and pathways associated with targeted drugs for NSCLC.webp
Jumat, 2025-06-20 03:17:14transcription. The lncRNA is a brand-new class of regulatory RNA. The LncRNA HOX antisense intergenic RNA (HOTAIR), an oncogene in NSCLC, is one of the significant...
Click to read more »
File:Olezarsen 2.svg
Jumat, 2026-04-10 08:37:34I, the copyright holder of this work, hereby publish it under the following license: English Schematic presentation of the olezarsen structure determination...
Click to read more »File:Tyrosine-kinase-inhibition-results-in-EGFR-clustering-at-focal-adhesions-and-consequent-exocytosis-1476-4598-7-47-S1.ogv
Minggu, 2026-06-07 18:19:35hesions-and-consequent-exocytosis-1476-4598-7-47-S1.ogv English: uPAR antisense transfection of ACCS cells effectively down-regulated the protein expression...
Click to read more »
File:MiRNA-biogenesis.jpg
Sabtu, 2024-12-14 22:03:07messenger RNA pre-miRNA = precursor microRNA miRNA = microRNA miRNA* = antisense microRNA miRNP = microRNA ribonucleoprotein עברית: תהליכים בסינתזה של...
Click to read more »
File:The zebrafish Pacsin3 orthologue.jpg
Minggu, 2024-05-05 08:25:13pacsin3 mRNA localization (purple) by whole mount in situ with pacsin3 antisense riboprobe at the various developmental stages noted. Anterior is left...
Click to read more ».jpg){kind=link}
File:GRI2012-585024.001 (1).jpg
Rabu, 2024-03-27 08:49:44(c) In mice, Igf2r is maternally expressed while the overlapping Airn antisense transcript is paternally expressed. Histone H3K4 methylation in the maternal...
Click to read more »
File:ALK2 is required for the expansion of the organizer domain Spemann's organizer.jpg
Jumat, 2025-02-07 08:39:45re-probed with an anti-actin antibody. b–m Embryos were injected with an antisense morpholino oligonucleotide specific for ALK2 (ALK2MO; 400 pg/embryo) or...
Click to read more ».jpg){kind=link}
File:Prion Protein and Mouse Nerve Cells (48440889002).jpg
Kamis, 2024-05-23 17:26:43lives, according to a new report in JCI Insight. The scientists used antisense oligonucleotides (ASOs), synthetic compounds that inhibit the formation...
Click to read more »File:Sequencing-of-Pax6-Loci-from-the-Elephant-Shark-Reveals-a-Family-of-Pax6-Genes-in-Vertebrate-pgen.1003177.s008.ogv
Selasa, 2020-11-03 00:37:08retina. 2 dpf zebrafish embryos were in situ hybridized with a pax6.2 antisense probe. A representative embryo was scanned by OPT and an AVI movie was...
Click to read more »File:Inactivation-of-ca10a-and-ca10b-Genes-Leads-to-Abnormal-Embryonic-Development-and-Alters-Movement-pone.0134263.s006.ogv
Senin, 2024-08-19 05:37:38English determination method or standard: SHA-1...
Click to read more »File:Inactivation-of-ca10a-and-ca10b-Genes-Leads-to-Abnormal-Embryonic-Development-and-Alters-Movement-pone.0134263.s005.ogv
Sabtu, 2025-03-08 21:10:37English determination method or standard: SHA-1...
Click to read more »File:Inactivation-of-ca10a-and-ca10b-Genes-Leads-to-Abnormal-Embryonic-Development-and-Alters-Movement-pone.0134263.s004.ogv
Senin, 2025-11-03 04:01:16English determination method or standard: SHA-1...
Click to read more »File:Neuromuscular-regulation-in-zebrafish-by-a-large-AAA+-ATPaseubiquitin-ligase-mysterinRNF213-srep16161-s3.ogv
Rabu, 2025-06-25 20:49:32English...
Click to read more »File:Early-pathogenesis-of-Duchenne-muscular-dystrophy-modelled-in-patient-derived-human-induced-srep12831-s1.ogv
Selasa, 2025-12-16 20:12:57English determination method or standard: SHA-1...
Click to read more »File:Neuromuscular-regulation-in-zebrafish-by-a-large-AAA+-ATPaseubiquitin-ligase-mysterinRNF213-srep16161-s2.ogv
Rabu, 2025-06-25 20:49:24English...
Click to read more »File:Neuromuscular-regulation-in-zebrafish-by-a-large-AAA+-ATPaseubiquitin-ligase-mysterinRNF213-srep16161-s4.ogv
Rabu, 2025-06-25 20:49:38English...
Click to read more »File:Knockdown-of-ApoL1-in-Zebrafish-Larvae-Affects-the-Glomerular-Filtration-Barrier-and-the-Expression-pone.0153768.s006.ogv
Minggu, 2020-09-06 09:54:30English...
Click to read more »File:Structural-Requirements-for-PACSINSyndapin-Operation-during-Zebrafish-Embryonic-Notochord-pone.0008150.s011.ogv
Rabu, 2025-06-25 20:19:44English...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S4.ogv
Selasa, 2025-01-07 22:38:13English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S1.ogv
Rabu, 2026-04-08 09:34:49English determination method or standard: SHA-1...
Click to read more »File:Multicolor-fluorescent-in-situ-hybridization-to-define-abutting-and-overlapping-gene-expression-in-1749-8104-6-10-S1.ogv
Sabtu, 2023-02-18 10:55:49English...
Click to read more »File:BDNF-promotes-target-innervation-of-Xenopus-mandibular-trigeminal-axons-in-vivo-1471-213X-7-59-S1.ogv
Kamis, 2025-05-08 21:01:22English determination method or standard: SHA-1...
Click to read more »File:BDNF-promotes-target-innervation-of-Xenopus-mandibular-trigeminal-axons-in-vivo-1471-213X-7-59-S5.ogv
Kamis, 2025-05-08 21:03:04English determination method or standard: SHA-1...
Click to read more »File:Diaphanous-Related-Formin-2-and-Profilin-I-Are-Required-for-Gastrulation-Cell-Movements-pone.0003439.s008.ogv
Senin, 2026-04-27 00:06:44English determination method or standard: SHA-1...
Click to read more »File:Knockdown-of-ApoL1-in-Zebrafish-Larvae-Affects-the-Glomerular-Filtration-Barrier-and-the-Expression-pone.0153768.s005.ogv
Kamis, 2026-01-01 05:16:27English determination method or standard: SHA-1...
Click to read more »File:The-Regenerative-Plasticity-of-Isolated-Urodele-Myofibers-and-Its-Dependence-on-Msx1-pbio.0020218.sv001.ogv
Sabtu, 2026-05-02 16:12:18English determination method or standard: SHA-1...
Click to read more »File:BDNF-promotes-target-innervation-of-Xenopus-mandibular-trigeminal-axons-in-vivo-1471-213X-7-59-S2.ogv
Kamis, 2025-05-08 21:02:43English determination method or standard: SHA-1...
Click to read more »File:Knockdown-of-ApoL1-in-Zebrafish-Larvae-Affects-the-Glomerular-Filtration-Barrier-and-the-Expression-pone.0153768.s007.ogv
Sabtu, 2026-02-07 10:25:19English determination method or standard: SHA-1...
Click to read more »File:BDNF-promotes-target-innervation-of-Xenopus-mandibular-trigeminal-axons-in-vivo-1471-213X-7-59-S3.ogv
Kamis, 2025-05-08 21:02:52English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S11.ogv
Minggu, 2024-12-22 11:09:55English determination method or standard: SHA-1...
Click to read more »File:Diaphanous-Related-Formin-2-and-Profilin-I-Are-Required-for-Gastrulation-Cell-Movements-pone.0003439.s007.ogv
Senin, 2026-04-27 00:06:43English determination method or standard: SHA-1...
Click to read more »File:Structural-Requirements-for-PACSINSyndapin-Operation-during-Zebrafish-Embryonic-Notochord-pone.0008150.s008.ogv
Rabu, 2025-06-25 20:19:01English...
Click to read more »File:Knockdown-of-ApoL1-in-Zebrafish-Larvae-Affects-the-Glomerular-Filtration-Barrier-and-the-Expression-pone.0153768.s008.ogv
Minggu, 2026-05-03 13:48:39English determination method or standard: SHA-1...
Click to read more »File:Diaphanous-Related-Formin-2-and-Profilin-I-Are-Required-for-Gastrulation-Cell-Movements-pone.0003439.s009.ogv
Senin, 2026-04-27 00:06:45English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S2.ogv
Jumat, 2026-03-20 23:17:49English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S8.ogv
Selasa, 2024-08-20 10:10:10English determination method or standard: SHA-1...
Click to read more »File:Structural-Requirements-for-PACSINSyndapin-Operation-during-Zebrafish-Embryonic-Notochord-pone.0008150.s010.ogv
Rabu, 2025-06-25 20:19:22English...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S7.ogv
Rabu, 2026-04-15 17:03:21English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S13.ogv
Rabu, 2024-09-11 21:11:07English determination method or standard: SHA-1...
Click to read more »File:Diaphanous-Related-Formin-2-and-Profilin-I-Are-Required-for-Gastrulation-Cell-Movements-pone.0003439.s006.ogv
Senin, 2026-04-27 00:06:42English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S12.ogv
Selasa, 2026-05-19 05:37:06English determination method or standard: SHA-1...
Click to read more »File:Structural-Requirements-for-PACSINSyndapin-Operation-during-Zebrafish-Embryonic-Notochord-pone.0008150.s009.ogv
Rabu, 2025-06-25 20:19:10English...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S17.ogv
Selasa, 2026-05-19 05:37:07English determination method or standard: SHA-1...
Click to read more »File:Small-RNA-Based-Antiviral-Defense-in-the-Phytopathogenic-Fungus-Colletotrichum-higginsianum-ppat.1005640.s003.ogv
Sabtu, 2025-10-04 14:18:40English determination method or standard: SHA-1...
Click to read more »File:Dynamics-of-degeneration-and-regeneration-in-developing-zebrafish-peripheral-axonsreveals-a-1749-8104-7-19-S6.ogv
Selasa, 2026-05-19 05:37:07English determination method or standard: SHA-1...
Click to read more »File:Mechanisms-Underlying-Metabolic-and-Neural-Defects-in-Zebrafish-and-Human-Multiple-Acyl-CoA-pone.0008329.s013.ogv
Kamis, 2022-05-19 02:58:05English...
Click to read more »File:Ptenb-Mediates-Gastrulation-Cell-Movements-via-Cdc42AKT1-in-Zebrafish-pone.0018702.s006.ogv
Rabu, 2025-06-25 20:54:49English...
Click to read more »File:Ptenb-Mediates-Gastrulation-Cell-Movements-via-Cdc42AKT1-in-Zebrafish-pone.0018702.s004.ogv
Kamis, 2026-01-01 20:37:19English determination method or standard: SHA-1...
Click to read more »File:Ptenb-Mediates-Gastrulation-Cell-Movements-via-Cdc42AKT1-in-Zebrafish-pone.0018702.s003.ogv
Kamis, 2026-01-01 19:52:36English determination method or standard: SHA-1...
Click to read more »File:Ptenb-Mediates-Gastrulation-Cell-Movements-via-Cdc42AKT1-in-Zebrafish-pone.0018702.s005.ogv
Kamis, 2026-01-01 20:36:07English...
Click to read more »File:Ptenb-Mediates-Gastrulation-Cell-Movements-via-Cdc42AKT1-in-Zebrafish-pone.0018702.s002.ogv
Kamis, 2026-01-01 20:39:04English...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s017.ogv
Sabtu, 2024-05-04 15:15:26English determination method or standard: SHA-1...
Click to read more »File:Mechanisms-Underlying-Metabolic-and-Neural-Defects-in-Zebrafish-and-Human-Multiple-Acyl-CoA-pone.0008329.s014.ogv
Kamis, 2022-05-19 02:58:24English...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s018.ogv
Sabtu, 2024-05-04 15:15:27English determination method or standard: SHA-1...
Click to read more »File:Identification-and-Functional-Analysis-of-the-Vision-Specific-BBS3-(ARL6)-Long-Isoform-pgen.1000884.s005.ogv
Kamis, 2026-01-01 19:31:15English...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s013.ogv
Sabtu, 2024-05-04 15:15:22English determination method or standard: SHA-1...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s015.ogv
Sabtu, 2024-05-04 15:15:24English determination method or standard: SHA-1...
Click to read more »File:DNAH6-and-Its-Interactions-with-PCD-Genes-in-Heterotaxy-and-Primary-Ciliary-Dyskinesia-pgen.1005821.s014.ogv
Sabtu, 2024-05-04 15:15:23English determination method or standard: SHA-1...
Click to read more »File:Role-of-the-2-zebrafish-survivin-genes-in-vasculo-angiogenesis-neurogenesis-cardiogenesis-and-1471-213X-9-25-S5.ogv
Kamis, 2026-01-01 17:36:30English...
Click to read more ».jpg){kind=link}
File:The Biological bulletin (20379569395).jpg
Jumat, 2024-06-14 16:29:27primer. Me 13. corresponds to a part of the nonrepetitive region and the antisense primer. Me 14, to a part of the 3' un- translated region, the whole repetitive...
Click to read more »File:Role-of-the-2-zebrafish-survivin-genes-in-vasculo-angiogenesis-neurogenesis-cardiogenesis-and-1471-213X-9-25-S7.ogv
Jumat, 2026-06-05 15:08:31English determination method or standard: SHA-1...
Click to read more »File:Role-of-the-2-zebrafish-survivin-genes-in-vasculo-angiogenesis-neurogenesis-cardiogenesis-and-1471-213X-9-25-S6.ogv
Kamis, 2026-01-01 18:41:22English...
Click to read more ».jpg){kind=link}
File:The Biological bulletin (20385712161).jpg
Minggu, 2024-07-14 18:12:51primer. Me 13. corresponds to a part of the nonrepetitive region and the antisense primer. Me 14, to a part of the 3' un- translated region, the whole repetitive...
Click to read more »