Focadhesin

FOCAD
Identifiers
AliasesFOCAD, KIAA1797, focadhesin
External IDsOMIM: 614606; MGI: 2676921; GeneCards: FOCAD
Orthologs
DatabasesNCBI: entry; OMA: entry
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

NM_017794
NM_001375567
NM_001375568
NM_001375570

NM_001081184

RefSeq (protein)

NP_060264
NP_001362496
NP_001362497
NP_001362499

NP_001074653

Location (UCSC)Chr 9: 20.66 – 21 MbChr 4: 88.09 – 88.41 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

Focadhesin is a protein that in humans is encoded by the FOCAD gene.[5]. FOCAD is also known as KIAA1797.

A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.[6]

Gene

KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.[5] Located on chromosome 9 at area p21.3,[7] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields an mRNA of 6117 base pairs.

Expression

KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression has been observed in tissues ranging from reproductive to secretory.[8]

KIAA1797 expression image

mRNA

Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are ugagaugaacucgguaucuca and uccuaagagaggag, respectively. Other possible secondary structures are shown in the table below.

Protein sequence

The main isoform of the human protein is 1801 amino acids long, a total of 200,072 Da.[7]

Two distinct domains of unknown function (DUF) are found in the sequence. DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was available regarding this DUF.

KIAA1797 DUF image

Homology

KIAA1797 is well conserved in mammals, but it is also found in nonmammalians with lower sequence identities.

Ort of KIAA1797

Gene neighborhood

KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.

KIAA1797 gene hood

Function

The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane protein.

References

  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000188352Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000038368Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ a b "Entrez Gene: KIAA1797".
  6. ^ Melton PE, Rutherford S, Voruganti VS, Göring HH, Laston S, Haack K, Comuzzie AG, Dyer TD, Johnson MP, Kent JW, Curran JE, Moses EK, Blangero J, Barac A, Lee ET, Best LG, Fabsitz RR, Devereux RB, Okin PM, Bella JN, Broeckel U, Howard BV, MacCluer JW, Cole SA, Almasy L (September 2010). "Bivariate genetic association of KIAA1797 with heart rate in American Indians: the Strong Heart Family Study". Hum. Mol. Genet. 19 (18): 3662–71. doi:10.1093/hmg/ddq274. PMC 2928129. PMID 20601674.
  7. ^ a b AceView NCBI Gene Information AceView Archived November 28, 2005, at the Wayback Machine
  8. ^ "EST Profile – Hs.283322". National Center for Biotechnology Information, United States National Library of Medicine. Archived from the original on January 30, 2016.

Further reading

Content Disclaimer

Informasi ini disarikan dari Wikipedia dan disajikan kembali untuk tujuan edukasi. Konten tersedia di bawah lisensi CC BY-SA 3.0. Kami tidak bertanggung jawab atas ketidakakuratan data yang bersumber dari kontribusi publik tersebut.

  1. The information displayed on this website is sourced in part or in whole from Wikipedia and has been adapted for the purpose of restating it. We strive to provide accurate and relevant information, however:
  2. There is no guarantee of absolute accuracy. Wikipedia is an open, collaborative project that can be edited by anyone, so information is subject to change.
  3. It is not intended to constitute professional advice. The content displayed is for informational and educational purposes only. For important decisions (e.g., medical, legal, or financial), please consult a professional.
  4. Content copyright. Wikipedia is licensed under the Creative Commons Attribution-ShareAlike License (CC BY-SA). This means that content may be reused with appropriate attribution and shared under a similar license.
  5. Responsible use. Any risk arising from the use of information from this website is entirely the responsibility of the user.