FAM200C
Family with Member 200 C (FAM200C) is a protein, which in humans is encoded by the FAM200C gene. The primary aliases of the gene are ZBED8, C5orf54, and Buster3.[1]
Gene
In the human genome, FAM200C is located on the minus strand of chromosome 5, at 5q33.3. FAM200C can be transcribed into 2 different transcript variants, which contain 3 and 2 exons, respectively.[1]

Expression
FAM200C is expressed ubiquitously and variably in human tissues, with a 10-fold difference between the lowest and highest expression values (~0.23-2.3).[1] FAM200C has the highest tissue expression in the ovaries, followed by the endometrium, thyroid, testis, and prostate.[2]
mRNA
FAM200C mRNA has 2 transcript variants. FAM200C Variant 1 is the longest in terms of nucleotide length, spanning 2,882 nucleotides.[1]
| Transcript Variant | Variant Length (nt) | Accession Number | Protein | Protein Length (aa) |
|---|---|---|---|---|
| FAM200C Variant 1 | 2,882 | NM_001303251.2 | NP_001290180.1 | 594 |
| FAM200C Variant 2 | 2,808 | NM_022090.5 | NP_071373.2 | 594 |
Protein
The Family with Sequence Similarity 200 Member C protein in Homo sapiens is encoded by the FAM200C gene. Protein FAM200C has a predicted molecular weight of 68326.71 Da, with a theoretical isoelectric point of 5.98.[3] The protein is localized to the Nucleoplasm.[4]
Promoter
Using UCSC's Genome Browser, a promoter region sequence was found. The most likely promoter region for FAM200C starts at 160,399,954 and goes to 160,400,554, with a length of 601 base pairs.[5]
Protein interactions
| Protein | Full Name | Description | Score |
|---|---|---|---|
| METTL21A | Methyltransferase 21A, HSPA Lysine | Enables ATPase binding activity, Hsp70 protein binding activity, and protein-lysine N-methyltransferase activity[7] | 0.732 |
| PGBD2 | PiggyBac transposable element derived 2 | Protein-coding gene, that interacts directly with DNA.[8] | 0.692 |
| THAP9 | THAP domain containing 9 | Enables sequence-specific DNA binding activity and transposase activity.[9] | 0.586 |
| GIN1 | Gypsy retrotransposon integrase 1 | Predicted to enable nucleic acid binding activity.[10] | 0.541 |
| CRLF3 | Cytokine receptor like factor 3 | Encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase.[11] | 0.505 |
| ZNF862 | Zinc finger protein 862 | Predicted to enable protein dimerization activity and zinc ion binding activity.[12] | 0.501 |
| POGK | Pogo transposable element derived with KRAB domain | Contains a KRAB domain at the N-terminus and a transposase domain at the C-terminus.[13] | 0.499 |
| PGBD1 | PiggyBac transposable element derived 1 | Belongs to the subfamily of piggyBac transposable element derived genes; expressed in the brain.[14] | 0.489 |
| PGBD5 | PiggyBac transposable element derived 5 | Belongs to the subfamily of piggyBac transposable element derived genes.[15] | 0.477 |
| NAIF1 | Nuclear apoptosis inducing factor 1 | Predicted to be involved in negative regulation of cell growth and regulation of mitochondrial membrane permeability involved in apoptotic process.[16] | 0.460 |
Structure
Secondary structure
The figure "FAM200C Predicted Secondary Structure" 1 and 2 provide a Phyre2.2 model prediction of FAM200C's secondary structure. Model indicates secondary structure is predicted to be composed of 9% disordered, 45% alpha helices, and 8% beta strands.[17]
![FAM200C Predicted Secondary Structure: Phyre2.2[17]](http://upload.wikimedia.org/wikipedia/commons/thumb/b/b0/FAM200C_Predicted_Secondary_Structure_1.png/250px-FAM200C_Predicted_Secondary_Structure_1.png?utm_source=en.wikipedia.org&utm_campaign=parser&utm_content=thumbnail)
![FAM200C Predicted Secondary Structure: Phyre2.2[17]](http://upload.wikimedia.org/wikipedia/commons/thumb/2/22/FAM200C_Predicted_Secondary_Structure_2.png/250px-FAM200C_Predicted_Secondary_Structure_2.png?utm_source=en.wikipedia.org&utm_campaign=parser&utm_content=thumbnail)
Tertiary structure
FAM200C tertiary structure predictions available through Phyre2.2 and AlphaFold.


Gene ontology
The figure titled "FAM200C Mature miRNA Sequences by Target Score" shows the 8 mature miRNA sequences for FAM200C available through text mining.[18]
| miRNA Name | Target Score | Seed Location | miRNA Sequence |
|---|---|---|---|
| hsa-miR-767-5p | 76 | 291 | UGCACCAUGGUUGUCUGAGCAUG |
| hsa-miR-627-3p | 73 | 171, 321 | UCUUUUCUUUGAGACUCACU |
| hsa-miR-550a-3p | 70 | 454 | UGUCUUACUCCCUCAGGCACAU |
| hsa-miR-4524a-3p | 65 | 64 | UGAGACAGGCUUAUGCUGCUAU |
| hsa-miR-942-5p | 62 | 326 | UCUUCUCUGUUUUGGCCAUGUG |
| hsa-miR-449c-5p | 60 | 188 | UAGGCAGUGUAUUGCUAGCGGCUGU |
| hsa-miR-34b-5p | 60 | 188 | UAGGCAGUGUCAUUAGCUGAUUG |
| hsa-miR-376c-3p | 60 | 95 | AACAUAGAGGAAAUUCCACGU |
Evolutionary history
FAM200C first arose around 94 million years ago. FAM200C is part of the Ribonuclease H-like superfamily.[1] A Swedish University for Agricultural Sciences research team led by Dr.Alexander Hayward and Dr.Awaisa Ghazal, studying the evolutionary origins of the ZBED genes published a paper in PLOS one, reporting that: "ZBED proteins, such as C5ORF54, or ZBED8, originated from domesticated hAT DNA transposons and encode regulatory proteins with diverse, fundamental functions in vertebrates."[19]
Orthologs
FAM200C orthologs were found exclusively in mammals. The most distantly related ortholog, Talpa occidentalis, has two transcript variants.[1]
| Taxonomic Class | Taxonomic Order | Genus and Species | Common Name | Date of Divergence (MYA) | Accession Number | Sequence Length (aa) | Sequence Identity (%) | Sequence Similarity (%) |
|---|---|---|---|---|---|---|---|---|
| Mammalia | Primates | Homo sapiens | Human | 0 | NP_001290180.1 | 594 | 100 | 100 |
| Mammalia | Primates | Gorilla gorilla gorilla | Gorilla | 8.6 | XP_004042980.2 | 594 | 99 | 100 |
| Mammalia | Primates | Macaca nemestrina | Pig-tailed macaque | 28.8 | XP_001084430.1 | 593 | 98 | 99 |
| Mammalia | Primates | Trachypithecus francoisi | Francois' langur | 28.8 | XP_033036286.1 | 593 | 98 | 99 |
| Mammalia | Primates | Cebus imitator | Panamanian white-faced capuchin | 43 | XP_017357604.1 | 594 | 97 | 100 |
| Mammalia | Primates | Saimiri boliviensis | Bolivian squirrel monkey | 43 | XP_074246649.1 | 633 | 97 | 100 |
| Mammalia | Primates | Otolemur garnettii | Small-eared gelago | 74 | XP_012664265.1 | 594 | 94 | 100 |
| Mammalia | Artiodactyla | Camelus dromedarius | Arabian camel | 94 | XP_010991120.3 | 594 | 94 | 100 |
| Mammalia | Perissodactyla | Equus quagga | Plains zebra | 94 | XP_046524538.1 | 641 | 94 | 100 |
| Mammalia | Carnivora | Leopardus geoffroyi | Geoffroy's cat | 94 | XP_045358866.1 | 594 | 94 | 100 |
| Mammalia | Carnivora | Mirounga leonina | Southern elephant seal | 94 | XP_034869533.1 | 594 | 94 | 100 |
| Mammalia | Carnivora | Zalophus californianus | California sea lion | 94 | XP_027462964.1 | 639 | 94 | 100 |
| Mammalia | Carnivora | Vulpes lagopus | Arctic fox | 94 | XP_041602806.1 | 593 | 94 | 100 |
| Mammalia | Carnivora | Neogale vison | American mink | 94 | XP_044086173.1 | 594 | 93 | 100 |
| Mammalia | Carnivora | Mustela lutreola | European mink | 94 | XP_059030193.1 | 549 | 93 | 100 |
| Mammalia | Chiroptera | Pteronotus mesoamericanus | Pteronotus parnellii mesoamericanus | 94 | XP_054423860.1 | 594 | 93 | 100 |
| Mammalia | Chiroptera | Molossus molossus | Pallas' mastiff bat | 94 | XP_036098001.1 | 594 | 92 | 100 |
| Mammalia | Eulipotypha | Talpa occidentalis | Iberian mole | 94 | XP_036098001.1 | 594 | 92 | 100 |
Paralogs
FAM200C has 18 paralogs. Based on target % identity to FAM200C (>20%), the three most significant paralogs are FAM200A, FAM200B, and ZBED5.
| Name | Full Name | Target % Identity | Sequence Length (aa) | Accession Number | Location |
|---|---|---|---|---|---|
| FAM200A | Family with Sequence Similarity 200 Member A | 29.49 | 573 | ENSG00000221909 | 7:99,546,300-99,559,392:-1 |
| FAM200B | Family with Sequence Similarity 200 Member B | 29.70 | 657 | ENSG00000237765 | 4:15,681,506-15,690,447:1 |
| ZBED5 | Zinc Finger BED-type Containing 5 | 27.13 | 693 | ENSG00000236287 | 11:10,812,074-10,858,796:-1 |
Multiple sequence alignment
The figure titled "Snippet of FAM200C Orthologs Multiple Sequence Alignment" shows a snippet of the multiple sequence alignment for FAM200C orthologs.[20] This snippet represents the conservation of FAM200C as most of the sequence is conserved.

Protein divergence
As shown in the figure titled "Informational context of FAM200C human protein...", the human FAM200C protein, is evolving slowly over time in comparison to both Fibrinogen Alpha and Cytochrome C.[1]

Conceptual translation
The figure titled "Conceptual Translation for FAM200C" shows the conceptual translation (full mRNA and amino acid sequence) of the human FAM200C transcript variant 1 showing exon boundaries, domains/motifs, polyadenylation sites, and phosphorylation sites, and a legend.



Single nucleotide polymorphisms
There are 3734 single nucleotide polymorphisms catalogued in NCBI's Variation Viewer, only one of which has a clinical significance record.[21] The only clinically significant single nucleotide polymorphism found, rs61740683, is a synonymous, single nucleotide variant with benign clinical significance.[22]
Clinical significance
FAM200C promoter could have a dual function as it starts transcription for the FAM200C gene and also an enhancer for the gene miR-146a. In a 2023 study published to the Arthritis and Rheumatology Journal for the American College of Rheumatology, researchers Xinyi Zhu, et al. discovered that when the FAM200C gene was knocked down, the expression levels for miR-146a were unaffected. This suggests that the promoter regions could also function as enhancers and regulate the expression of genes in close proximity.[23] FAM200C is also a potential biomarker for Sarcoidosis. In a 2020 study published to the Medical Science Monitor, Min Zhao et al. identified FAM200C as a "SARC-only DEG". The researchers found that FAM200C is up-regulated in Sarcoidosis, meaning there is increased gene expression in patients with Sarcoidosis compared to patients with Pulmonary Tuberculosis and healthy control patients.[24]
Text-Based Information
References
- ^ a b c d e f g "FAM200C family with sequence similarity 200 member C [Homo sapiens (human)]". National Library of Medicine: National Center for Biotechnology Information. 25 November 2025. Retrieved 20 September 2025.
- ^ Fagerberg, Linn; Hallström, Björn M.; Oksvold, Per; Kampf, Caroline; Djureinovic, Dijana; Odeberg, Jacob; Habuka, Masato; Tahmasebpoor, Simin; Danielsson, Angelika; Edlund, Karolina; Asplund, Anna; Sjöstedt, Evelina; Lundberg, Emma; Szigyarto, Cristina Al-Khalili; Skogs, Marie (February 2014). "Analysis of the Human Tissue-specific Expression by Genome-wide Integration of Transcriptomics and Antibody-based Proteomics". Molecular & Cellular Proteomics. 13 (2): 397–406. doi:10.1074/mcp.M113.035600. PMC 3916642. PMID 24309898.
- ^ "Expasy — Compute pI/MW". web.expasy.org. Retrieved 2025-12-03.
- ^ Thul, Peter J.; Åkesson, Lovisa; Wiking, Mikaela; Mahdessian, Diana; Geladaki, Aikaterini; Ait Blal, Hammou; Alm, Tove; Asplund, Anna; Björk, Lars; Breckels, Lisa M.; Bäckström, Anna; Danielsson, Frida; Fagerberg, Linn; Fall, Jenny; Gatto, Laurent (2017-05-26). "A subcellular map of the human proteome". Science. 356 (6340) eaal3321. Bibcode:2017Sci...356l3321T. doi:10.1126/science.aal3321. ISSN 0036-8075. PMID 28495876.
- ^ "UCSC Genome Browser on Human (GRCh38/hg38)". Retrieved 2025-12-03.
- ^ "ZBED8 protein (human) — STRING interaction network". string-db.org. Retrieved 2025-12-01.
- ^ METTL21A – methyltransferase 21A, HSPA lysine. NCBI Gene 151194.
- ^ PGBD2 – piggyBac transposable element derived 2. NCBI Gene 267002.
- ^ THAP9 – THAP domain containing 9. NCBI Gene 79725. Alliance of Genome Resources HGNC:23192
- ^ GIN1 – gypsy retrotransposon integrase 1. NCBI Gene 54826. Alliance of Genome Resources HGNC:25959
- ^ CRLF3 – cytokine receptor like factor 3. NCBI Gene 51379.
- ^ ZNF862 – zinc finger protein 862. NCBI Gene 643641. Alliance of Genome Resources HGNC:34519
- ^ POGK – pogo transposable element derived with KRAB domain. NCBI Gene 57645.
- ^ PGBD1 – piggyBac transposable element derived 1. NCBI Gene 84547.
- ^ PGBD5 — piggyBac transposable element derived 5. NCBI Gene 79605.
- ^ NAIF1 – nuclear apoptosis inducing factor 1. NCBI Gene 203245. Alliance of Genome Resources HGNC:25446
- ^ a b c Powell HR, Islam SA, David A, Sternberg MJ (August 2025). "Phyre2.2: A Community Resource for Template-based Protein Structure Prediction". J Mol Biol. 437 (15) 168960. doi:10.1016/j.jmb.2025.168960. PMC 7617537. PMID 40133783.
- ^ Chen Y, Wang X (January 2020). "miRDB: an online database for prediction of functional microRNA targets". Nucleic Acids Res. 48 (D1): D127–31. doi:10.1093/nar/gkz757. PMC 6943051. PMID 31504780.
- ^ Hayward, Alexander; Ghazal, Awaisa; Andersson, Göran; Andersson, Leif; Jern, Patric (2013-03-22). Robinson-Rechavi, Marc (ed.). "ZBED Evolution: Repeated Utilization of DNA Transposons as Regulators of Diverse Host Functions". PLOS ONE. 8 (3) e59940. Bibcode:2013PLoSO...859940H. doi:10.1371/journal.pone.0059940. PMC 3606216. PMID 23533661.
- ^ Madeira F, Madhusoodanan N, Lee J, Eusebi A, Niewielska A, Tivey ARN, Lopez R, Butcher S. (2024). The EMBL-EBI Job Dispatcher sequence analysis tools framework in 2024. Nucleic Acids Research, April 10, 2024; doi: 10.1093/nar/gkae241; Europe PMC: 38597606
- ^ "Variation Viewer". www.ncbi.nlm.nih.gov. Retrieved 2025-12-13.
- ^ "Supplemental Information 3: Perl script to parse ClinVar entries". doi:10.7717/peerj.8106/supp-3.
- ^ Zhu X, Zhang Y, Yin Z, Ye Z, Qin Y, Cheng Z, Shen Y, Yin Z, Ma J, Tang Y, Ding H, Guo Y, Hou G, Shen N (March 2024). "Three-Dimensional Chromosomal Landscape Revealing miR-146a Dysfunctional Enhancer in Lupus and Establishing a CRISPR-Mediated Approach to Inhibit the Interferon Pathway". Arthritis Rheumatol. 76 (3): 384–395. doi:10.1002/art.42703. PMID 37728419.
- ^ Zhao M, Di X, Jin X, Tian C, Cong S, Liu J, Wang K (July 2020). "Identification of Biomarkers for Sarcoidosis and Tuberculosis of the Lung Using Systematic and Integrated Analysis". Med Sci Monit. 26 e925438. doi:10.12659/MSM.925438. PMC 7397754. PMID 32701935.
Content Disclaimer
Informasi ini disarikan dari Wikipedia dan disajikan kembali untuk tujuan edukasi. Konten tersedia di bawah lisensi CC BY-SA 3.0. Kami tidak bertanggung jawab atas ketidakakuratan data yang bersumber dari kontribusi publik tersebut.
- The information displayed on this website is sourced in part or in whole from Wikipedia and has been adapted for the purpose of restating it. We strive to provide accurate and relevant information, however:
- There is no guarantee of absolute accuracy. Wikipedia is an open, collaborative project that can be edited by anyone, so information is subject to change.
- It is not intended to constitute professional advice. The content displayed is for informational and educational purposes only. For important decisions (e.g., medical, legal, or financial), please consult a professional.
- Content copyright. Wikipedia is licensed under the Creative Commons Attribution-ShareAlike License (CC BY-SA). This means that content may be reused with appropriate attribution and shared under a similar license.
- Responsible use. Any risk arising from the use of information from this website is entirely the responsibility of the user.